Specimens were collected in Suan Phueng District, Ratchaburi Province, Thailand by Parinya Pawangkhanant, Platon V. Yushchenko, Mali Naiduangchan, Chatmongkon Suwannapoom, and Nikolay A. Poyarkov during several field surveys from 2016 to 2019. The location of the surveyed locality and the distribution of the Thai-Burmese clade of Ansonia are shown in Figure 1. Geographic coordinates and elevation were obtained using a Garmin GPSMAP 60CSx and recorded in WGS 84 datum. Specimens were collected by hand, euthanized with 20% benzocaine solution, femoral muscle or liver tissue samples removed, and then fixed in 10% buffered formalin before preserving in 70% ethanol. The tissue samples were stored in 95% ethanol. Specimens and tissues were subsequently deposited in the herpetological collections of the School of Agriculture and Natural Resources, University of Phayao (AUP, Phayao, Thailand) and of the Zoological Museum of Moscow University (ZMMU, Moscow, Russia).

Specimen collection and animal use protocols were approved by the Institutional Ethical Committee of Animal Experimentation of the University of Phayao, Phayao, Thailand (certificate number UP-AE61-01-04-022, issued to Chatmongkon Suwannapoom) and were strictly complacent with the ethical conditions of the Thailand Animal Welfare Act. Field work, including collection of animals in the field and specimen exportation, was authorized by the Institute of Animals for Scientific Purpose Development (IAD), Bangkok, Thailand (permit numbers U1-01205-2558 and UP-AE59-01-04-0022, issued to Chatmongkon Suwannapoom).

Observations on color pattern were based on the examination of specimens in life as well as digital images of living and euthanized specimens prior to preservation. Measurements were recorded with a Mitutoyo dial caliper under a Nikon SMZ 1500 dissecting microscope to the nearest 0.01 mm. Measurements of adult specimens generally following Wilkinson et al. (2012) were: snout-vent length (SVL, from tip of snout to vent); head length (HL, from tip of snout to hind border of angle of jaw); head width (HW, width of head at its widest point); snout width (SW, width of snout at anterior corner of eyes); snout length (SL, from anterior border of eye to tip of snout); distance from nostril to eye (DNE, from center of nostril to anterior border of eye); internarial distance (IND, distance between center of nares); interorbital distance (IOD, minimum distance between upper eyelids); eye diameter (ED, horizontal diameter of eye); upper eyelid width (UEW, greatest transverse width of eyelid); vertical tympanum diameter (VTD; vertical diameter of tympanum); horizontal tympanum diameter (HTD; horizontal diameter of tympanum); tympanum to eye distance (T-ED, from anterior edge of tympanum to posterior edge of eye); forearm length (FAL, from elbow to tip of third finger); hand length (HAL, from proximal edge of palmar tubercle to tip of third finger); first finger length (1FL, from distal end of inner metacarpal tubercle to tip of first finger); thigh length (THL, from vent to knee); tibia length (TIL, from knee to ankle); foot length (FL, from proximal end of outer metatarsal tubercle to tip of fourth toe); first toe length (1TL, from distal end of inner metatarsal tubercle to tip of first toe); inner metatarsal tubercle length (IMTL, greatest length of tubercle); outer metatarsal tubercle length (OMTL, greatest length of tubercle); third finger disk width (3FDW, maximal width of terminal disk on third finger); hindlimb length (HLL, length of straightened hindlimb from groin to tip of fourth toe); and forelimb length (FLL, length of straightened forelimb from axilla to tip of third finger) (Table 1).

Measurements on a single tadpole specimen AUP-02091 followed Inger (1985) and Wilkinson et al. (2012), and were taken under a Nikon SMZ 1500 dissecting microscope with a micrometer as follows: total length, head-body length (tip of snout to insertion of tail), head-body depth, maximum head-body width, diameter of eyeball, interorbital distance, eye to tip of snout, internarial distance, width of oral disc, tail length, maximum tail depth, tail muscular depth, thigh length, tibia length, and foot length. Tadpole staging followed Gosner (1960), oral apparatus terminology followed Altig and McDiarmid (1999), and labial tooth row formula followed Altig et al. (1998).

The morphospatial clustering among sampled individuals from a selected subset of species and characters for which there was full coverage for each species were visualized using principal component analysis (PCA) from the ADEGENET package in R (Jombart et al. 2010). Only males were used in the analysis because only one female of Ansonia thinthinae was available. Characters analyzed were HL, HW, SL, ED, HTD, IND, IOD, FL, and TIL. To remove potential effects of allometry, size was normalized using the following equation: X_adj=log(X)-β[log(SVL)-log(SVL_mean)], where X_adj=adjusted value; X=measured value; β=unstandardized regression coefficient for each population; and SVL_mean=overall average SVL of all populations (Thorpe 1975, 1983; Turan 1999; Lleonart et al. 2000, accessible in the R package GroupStruct (available at https://github.com/chankinonn/GroupStruct). The morphometrics of each species were normalized separately and then concatenated so as not to conflate intra- with interspecific variation (Reist 1986). All data were scaled to their standard deviation to insure they were analyzed on the basis of correlation and not covariance. For corroboration, a discriminant analysis of principal components (DAPC) was performed on the same data set. DAPC relies on scaled data calculated from its own internal PCA as a prior step to ensure that variables analyzed are not correlated and number fewer than the sample size. Dimension reduction of the DAPC prior to plotting, is accomplished by retaining the first set of PCs that account for 90–99% of the variation in the data set (Jombart and Collins 2015) as determined from a scree plot generated as part of the analysis.

Two-sample t-tests of the all the scaled mensural characters were used to search for statistically significant mean morphometric differences between the new Thai population and its sister species, A. thinthinae (see below). Characters were subjected to an F-test to test for homogeneity of variances. Those with unequal variances were subjected to a Welch’s t-test and those with equal variances were subjected to a Student t-test. All statistical analyses were performed in R [v3.4.3]. Raw and adjusted data are presented in Table S1.

For the molecular phylogenetic analyses, we extracted the total genomic DNA from ethanol-preserved femoral muscle tissue of six specimens of the new Thai population using standard phenol-chloroform-proteinase K extraction procedures with consequent isopropanol precipitation, for a final concentration of about 1 mg/ml (protocols followed Hillis et al. (1996) and Sambrook and David (2001)). We visualized the isolated total genomic DNA in agarose electrophoresis in the presence of ethidium bromide. We measured the concentration of total DNA in 1 μl using NanoDrop 2000 (Thermo Scientific), and consequently adjusted to ca. 100 ng DNA/μL.

We amplified mtDNA fragments covering partial 16S rRNA gene sequences to obtain a 560 bp-length continuous fragment per specimen. The 16S rRNA gene has widely been applied in biodiversity surveys in amphibians (Vences et al. 2005a, 2005b; Vieites et al. 2009), and has been used in the most of the recent phylogenetic studies on Ansonia (e.g. Grismer et al. 2016; Matsui et al. 2007; Matsui et al. 2010; Wilkinson et al. 2012). We performed DNA amplification in 20 μl reactions using ca. 50 ng genomic DNA, 10 nMol of each primer, 15 nMol of each dNTP, 50 nMol additional MgCl₂, Taq PCR buffer (10 mM Tris-HCl, pH 8.3, 50 mM KCl, 1.1 mM MgCl₂ and 0.01% gelatine) and 1 unit of Taq DNA polymerase. Primers used in the PCR and sequencing include 16sL1 (CTGACCGTGCAAAGGTAGCGTAATCACT) and 16H-1 (CTCCGGTCTGAACTCAGATCACGTAGG) (Hedges 1994). The PCR conditions included an initial denaturation step of 5 min at 94°C and 43 cycles of denaturation for 1 min at 94°C, primer annealing for 1 min with the TouchDown program from 65 to 55°C reducing 1°C every cycle, and extension for 1 min at 72°C, and a final extension step for 5 min at 72°C.

PCR products were loaded onto 1.5% agarose gels in the presence of ethidium bromide and visualized in agarose electrophoresis. When distinct bands were produced, we purified the PCR products using 2 μl of a 1:4 dilution of ExoSapIt (Amersham) per 5 μl of PCR product prior to cycle sequencing. A 10 μl sequencing reaction included 2 μL of template, 2.5 μl of sequencing buffer, 0.8 μl of 10 pMol primer, 0.4 μl of BigDye Terminator version 3.1 Sequencing Standard (Applied Biosystems) and 4.2 μl of water. The cyclesequencing used 35 cycles of 10 sec at 96°C, 10 sec at 50°C and 4 min at 60°C. We purified the cyclesequencing products by ethanol precipitation. We carried out sequence data collection and visualization on an ABI 3730xl Automated Sequencer (Applied Biosystems).

Ingroup samples consisted of 128 individuals representing 32 nominal species and included three of the six samples from the new Thai population. Outgroups used to root the tree were Rentapia hosii (Boulenger), Pelophryne brevipes (Peters), P. misera (Mocquard), and P. signata (Boulenger) based in part on the phylogenetic results of Chan et al. (2014), Grismer et al. (2016), Matsui et al. (2007, 2010), and Wilkinson et al. (2012). Sequence data generated for the six individuals from the new Thai population are deposited in GenBank under the accession numbers MZ823491–MZ823496. Sequences for all other individuals were downloaded from GenBank and are listed in Quah et al. (2019: Table 2).

Maximum Likelihood (ML) and Bayesian Inference (BI) were used to estimate phylogenetic trees. Best-fit models of evolution were determined in IQ-TREE (Nguyen et al. 2015) using the Bayesian information criterion (BIC) implemented in ModelFinder (Kalyaanamoorthy et al. 2017). TIM2+F+I+G4 was the best-fit model of evolution for both 12S and 16S. The ML analysis was performed using the IQ-TREE webserver (Trifinopoulos et al. 2016) with 1000 bootstrap pseudoreplicates using the ultrafast bootstrap (UFB) analysis (Minh et al. 2013; Hoang et al. 2018). The BI analysis was performed on CIPRES Science Gateway (Miller et al. 2010) using MrBayes v3.2.4 (Ronquist et al. 2012). Two independent runs were performed using Metropolis-coupled Markov Chain Monte Carlo (MCMCMC), each with four chains: three hot and one cold. The MCMCMC chains were run for 60,000,000 generations with the cold chain sampled every 6000 generations and the first 25% of each run being discarded as burn-in. The posterior distribution of trees from each run was summarized using the sumt function in MrBayes v3.2.4 (Ronquist et al. 2012).

Stationarity was checked with Tracer v1.6 (Rambaut et al. 2014) to be sure the effective sample sizes (ESS) for all parameters were greater than 200. We considered Bayesian posterior probabilities (BPP) of 0.95 and above and ultrafast bootstrap support values (UFB) of 95 and above as strong nodal support (Huelsenbeck et al. 2001; Minh et al. 2013). Uncorrected pairwise sequence divergences (p-distance) were calculated in MEGA v6.06 (Tamura et al. 2013) using the complete deletion option which removes gaps and missing data from the alignment prior to analysis.

The ML and BI analyses recovered nearly identical trees (Fig. 2). Both analyses recovered a strongly supported (UFB 100/BPP 1.00) Thai-Burmese clade of Ansonia composed of A. siamensis Kiew, A. khaochangensis Grismer, Wood, Aowopol, Cota, Grismer, Murdoch, Aguilar, and Grismer, A. pilokensis Matsui, Khouse, and Panha, A. phuketensis Matsui, Khonsue, and Panha, A. kyaiktiyoensis Quah, Grismer, Wood, Myint Kyaw Thura, Oaks, and Aung Lin, A. inthanon Matsui, Nabhitabhata, Panha, A. kraensis, A. thinthinae, and the new population from Suan Phueng District, Ratchaburi Province, Thailand. The Suan Phueng population was recovered as the strongly supported (100/1.00) sister species of A. thinthinae in both analyses with an uncorrected pairwise sequence divergence between them for the 16S rRNA gene of 4.1%. The only difference between the ML and BI analyses was the placement of A. pilokensis as a poorly supported (UFB 79) sister species of A. phuketensis in the ML analysis, whereas, in the BI analysis, these two species formed an unsupported polytomy with the remaining species in the Thai-Burmese clade. Their sister species relationship was poorly supported in both analyses (84/0.54) in Quah et al. (2019). All other relationships were in complete concordance with Quah et al. (2019).

The new Thai population from Suan Phueng and its sister species Ansonia thinthinae have statistically different head, body, and limb proportions (Tables 2, 3) with the former having a significantly shorter and wider head (HL and HW, respectively); shorter snout (SL); smaller eyes and tympana (ED and HTD, respectively); smaller internarial and interorbital diameters (IND and IOD, respectively); and shorter hind limbs (TIL and FL, respectively). The two populations are widely separated in the PCA (Fig. 2) where principal component (PC) 1 accounts for 63.8% of the variation in the dataset and loads most heavily for head width (HW), snout length (SL), limb length (FLL and HLL), and eye diameter (ED). PC 2 accounts for an additional 10.4% of the variation and loads most heavily for internarial distance (IND) (Table 4). The DAPC corroborates the PCA in that each population is completely separated from one another along the first discriminant function that accounts for 99.4% of the data set (Fig. 2). Based on all the above data, the new Thai population from Suan Phueng District is described below as a new species.