Research Article |
|
Corresponding author: Sarah Mângia ( sarahmangia@yahoo.com.br ) Academic editor: Raffael Ernst
© 2023 Sarah Mângia, Diego José Santana, Leandro de Oliveira Drummond, Leandro Talione Sabagh, Luiz Ugioni, Paulo Nogueira Costa, Milena Wachlevski.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Mângia S, Santana DJ, de Oliveira Drummond L, Sabagh LT, Ugioni L, Costa PN, Wachlevski M (2023) A new species of Brachycephalus (Anura: Brachycephalidae) from Serra do Tabuleiro, Southern Brazil. Vertebrate Zoology 73: 575-597. https://doi.org/10.3897/vz.73.e102098
|
The number of described species of Brachycephalus has rapidly increased in the last decade (n = 22, which represents 56% of the total). Species of the genus Brachycephalus are mostly distributed in isolated mountaintops from Bahia (northeastern Brazil) to Santa Catarina states (southern Brazil), each one occupying only one or a few adjacent mountaintops. Herein, we described a new species of Brachycephalus of the B. pernix group, from Serra do Tabuleiro in Santa Catarina state, which also represents the southernmost known species. The new species can be distinguished from its congeners by a combination of characters, including the following: (1) “bufoniform” body; (2) small adult SVL: 9.57–11.10 mm for males and 10.88–12.70 mm for females; (3) head proportionally small (HL/SVL 19–28%) and eye proportionally large (ED/HL 36–56%); (4) dorsum texture rough; (5) snout shape rounded in dorsal and lateral views; (6) general dorsal body color olive green with head, arms and legs yellow-orangish scattered with olive green, and an orangish vertebral stripe spotted with white and brown colors; (7) skull and skeleton without hyperossification; (8) frontoparietal and sphenethmoid not fused; (9) advertisement with one or two high-frequency notes (6,115–6,562 Hz), and 2–4 pulses per note. The type locality is adjacent to Parque Estadual da Serra do Tabuleiro, a protected area, but we observed various agricultural activities in this locality, including the presence of exotic plants, which can change the amount and the quality of leaf litter, somehow compromising the population of the new species. Another aggravating factor is that the municipality of São Bonifácio has conflicts over land use with irregular occupation and unfinished expropriation processes in Parque Estadual da Serra do Tabuleiro. Considering that Brachycephalus sp. nov. is probably a mountaintop microendemic species, it is paramount that future studies quantifying the new species’ full distribution and evaluating population trends to accurately assess its conservation status.
Amphibia, Atlantic Forest, Brachycephalus pernix group, endemism, integrative taxonomy, pumpkin toadlet, Santa Catarina State
The frog genus Brachycephalus currently comprises 39 species with distribution restricted to the Atlantic Rainforest from the southern state of Bahia to the state of Santa Catarina (
The known diversity of the genus Brachycephalus has increased considerably in the last decade with the description of 22 species (Frost et al. 2023). Most of this recently described species (14) are included in the B. pernix group which is currently the most species-rich on the genus, comprising 19 species distributed in Paraná and Santa Catarina states, Brazil: B. actaeus
Is consensus that the known taxonomic diversity in Brachycephalus tends to increase with additional surveys in mountain ranges of southern and southeastern Brazil (
We sampled individuals of new species during an inventory of the amphibians of the Parque Estadual da Serra do Tabuleiro, a conservation unit in the Serra do Tabuleiro mountain complex, eastern state of Santa Catarina, Southern Brazil. This protected area comprises 84.130 ha covered by a complex of phytogeographic units of Atlantic Rainforest (
We carried out two field expeditions to the western portion of the mountain complex, in November 2015 and in January 2018. Calls of the new species were recorded on an Ombrophilous Dense Forest portion at 900 meters high. On both occasions we camped next to the collection points where we heard the call, in order to collect the species and evaluate the daily cycle frogs’ vocalization activity. All specimens were collected by active searches on the leaf litter floor, with a sampling effort of 36.0 hours-person in 2015 and 36.7 hours-person in 2018. In 2018, we also used pitfall-traps (700 ml), totalizing 105 pitfalls-day, but without success in Brachycephalus capture. The collected specimens were killed using 5% lidocaine, had tissue samples (liver) taken, fixed in 10% formalin, and transferred to 70% ethanol for permanent storage (following Conselho Federal de Biologia-CFBio Nº 148/2012).
We compared the morphological traits based on the analysis of individuals housed in two herpetological collections: Museu de História Natural Capão da Imbuia and Museu Nacional do Rio de Janeiro (B. actaeus, B. albolineatus, B. auroguttatus, B. boticario, B. brunneus, B. coloratus, B. curupira, B. fuscolineatus, B. leopardus, B. mariaterezae, B. mirissimus, B. olivaceus, B. pernix, B. pombali, B. quiririensis, B. tridactylus, and B. verrucosus; see Appendix) and on the literature available for the remaining species of the genus.
We analyzed morphological data of the new species of Brachycephalus following the terminology for diagnostic features and morphological structures of
A single person (M. Wachlevski) took 14 measurements (in millimeters) of preserved type series specimens with a stereomicroscope Tecnival stereomicroscope, following
We cleared and stained the skeleton of three topotypes (CHSA.A 1404, MNRJ 93855 and UNIFESSPA 112, one female and two males, included in the sexed specimens presented in Table
Measurements in millimeters of the type series of Brachycephalus tabuleiro sp. nov.. Measurements abbreviations are listed in Material and Methods. Values are presented as mean ± SD (range).
| Measurements | Males (n = 8) | Females (n = 3) |
| SVL | 10.3±0.53 (9.57–11.10) | 11.75±0.91 (10.88–12.70) |
| HL | 2.33±0.36 (1.94–2.98) | 2.64±0.77 (2.02–3.50) |
| HW | 4.21±0.18 (4.00–4.56) | 4.31±0.51 (3.77–4.78) |
| ND | 0.17±0.03 (0.13–0.20) | 0.22±0.04 (0.18–0.25) |
| IND | 1.24±0.13 (1.04–1.45) | 2.46±0.28 (2.14–2.64) |
| ED | 1.10±0.07 (1.03–1.25) | 1.31±0.36 (0.98–1.70) |
| IOD | 2.30±0.17 (1.97–2.48) | 2.46±0.28 (2.64–2.14) |
| END | 0.48±0.04 (0.40–0.51) | 0.66±0.38 (0.43–1.10) |
| THL | 3.42±0.44 (2.62–3.90) | 3.66±0.57 (2.34–4.30) |
| TBL | 3.26±0.14 (3.10–3.49) | 3.44±0.05 (3.40–3.50) |
| FL | 4.09±0.17 (3.84–4.35) | 3.66±0.23 (3.40–3.85) |
| UAL | 1.75±0.20 (1.46–1.99) | 2.11±0.69 (1.63–2.90) |
| FAL | 2.35±0.17 (2.11–2.54) | 2.44±0.23 (2.29–2.70) |
| HAL | 1.84±0.05 (1.77–1.91) | 2.05±0.24 (1.82–2.30) |
We recorded the advertisement call of three males (unvouchered specimens). Two males were recorded with a Tascam DR-40 recorder with the device’s built-in microphones on 12 November 2015, around 10:30 a.m. and one individual was recorded with a Marantz PMD660 professional coupled to a unidirectional microphone Sennheiser ME67 on 7 January 2018, 4:15 p.m, in São Bonifácio municipality, Santa Catarina state. The calls were recorded at a sampling rate of 44.0 kHz and 16 bit resolution. We analyzed calls of four acoustic archives in Raven Pro1.5 for Mac (
We followed
Whole genomic DNA was extracted from liver tissue using the QIAGEN DNeasy Blood and Tissue Kit (QIAGEN). PCR amplification and sequencing was performed with the primers 16Sar-L (CGCCTGTTTATCAAAAACAT) and 16Sbr-H (CCGGTCTGAACTCAGATCACGT) of
MNRJ 93859, adult male, collected at Serra do Tabuleiro, São Bonifácio municipality, Santa Catarina state, Brazil (27°53’58”S, 48°53’5”W, 915 m.a.s.l.; datum = WGS84), on 12 November 2015, by L.O. Drummond, L.T. Sabagh, and L. Ugioni.
MHNCI 11498 (adult male), and UNIFESSPA 113 (adult female) collected with the holotype, CFBH 45453, CHSA.A 1403, MNRJ 93854–55, UNIFESSPA 112, ZUFMS-AMP14532 (adult males), CHSA.A 1404, and MHNCI 11499 (adult females) collected at the type locality, on 7 January 2018, by L. Ugioni, M. Wachlevski, B. Cesário, and D.C. Passos.
ZUFMS-AMP14531, MNRJ 93856–58 and, CFBH 45452 (adults not sexed) collected at the type locality, on 7 January 2018, by L. Ugioni, M. Wachlevski, B. Cesário, and D. C. Passos.
Brachycephalus tabuleiro is a new species of the B. pernix group and can be distinguished from its congeners using the following combination of characters: (1) “bufoniform” body; (2) small adult SVL: 9.57–11.10 mm for males (n = 6), 10.88–12.70 mm for females (n = 3); (3) head proportionally small (HL/SVL 19–28%) and eye proportionally large (ED/HL 36–56%); (4) dorsum texture rough; (5) snout shape rounded in dorsal and lateral views; (6) general dorsal body color olive green with head, arms and legs yellow-orangish scattered with olive green, and an orangish vertebral stripe spotted with white and brown colors; (7) background yellow-orangish in the ventral region with reticulated green stains, mainly concentrated in the peripheral portion; (8) fingers I and IV greatly reduced, represented externally by a small lump, finger II reduced but distinct, and finger III larger and robust; (9) tips of the fingers I, II, and III rounded; (10) toes I and V present but externally indistinguishable, toe II greatly reduced, toe III short and distinct, and toe IV larger and robust; (11) tips of the toes II, III, and IV rounded; (12) skull and skeleton without hyperossification; (13) frontoparietal and sphenethmoid not fused; (14) premaxillary odontoids presents; (15) relative lengths of the transverse processes in descending order: III > IV > V > II > VI > VII >VIII; (16) radius and ulna fused, (17) phalangeal formula of fingers 1-2-3-1; (18) phalangeal formula of toes 0-2-3-4-0; (19) advertisement with one or two high-frequency notes (6115.4–6562.5 Hz), and 2–4 pulses per note.
Live specimens of Brachycephalus tabuleiro. A UNIFESSPA 113 (adult male), B MHNCI 11498 (adult female), C MNRJ 93859 (adult male, holotype), D MHNCI 11498 (adult female), E MNRJ 93859 (adult male, holotype) and UNIFESSPA 113 (adult male), F CHSA.A 1404 (adult female), G and H ZUFMS-AMP 14531 (adult not sexed). Photos: Diego José Santana (A, B, C, D, E), Milena Wachlevski (F, G, H).
Characteristics of compared species are presented in parentheses. The new species presents a “bufoniform” body – term defined by
From species with “bufoniform” body, some degree of dorsal yellow-orangish coloration (except B. curupira and B. brunneus that present brown dorsal coloration, B. olivaceus and some specimens of B. actaeus that present dark-green dorsal coloration), and absence of dermal ossification, Brachycephalus tabuleiro differs by the following characteristics: (1) small body size SVL 9.57–11.10 mm in males, 10.88–12.70 mm in females [males SVL 11.6–12.5 mm and females SVL 13.0–14.5 mm in B. ferruginus (
Morphological and color variation of preserved specimens of Brachycephalus tabuleiro from Serra do Tabuleiro, São Bonifácio municipality, Santa Catarina state, Brazil. A UNIFESSPA 113 (adult male), B CFBH 45452 (adult not sexed), C MNRJ 93856 (adult not sexed), D CHSA.A 1403 (adult male), E MNRJ 93857 (adult not sexed), F MNRJ 93854 (adult male), G MNRJ 93857 (adult not sexed), H MNRJ 93855 (adult male), I CHSA.A 1404 (adult female), J UNIFESSPA 112 (adult male), K ZUFMS-AMP 14532 (adult male), L ZUFMS-AMP 14531 (adult not sexed), M MHNCI 11499 (adult female), N MHNCI 11498 (adult female), O MNRJ 93859 (adult male, holotype).
The advertisement call with one note of Brachycephalus tabuleiro differs from most of its congeners by a presence of pulsed notes with a lower number of pulses per note (2–4) [(13–17 in B. bufonoides (
Acoustic parameter of the advertisement call of the genus Brachycephalus. Values are presented as mean ± SD (range). Call duration in seconds (CD); Interval between calls (IC); Notes per call (NC); Note duration in seconds (ND1 for calls with only one note and note one in calls with two notes; ND2 for note two in calls with two notes); Interval between notes in seconds (NI); Note rate in notes/s (NR); Number of pulses per note (PN); Pulse rate in pulses/s (PR); Dominant frequency in Hz (DF). *Note-centered approach (we consider the duration of the notes as call duration, see Material and Methods). **Based on six calls of fig. 7 in
| Species | n | CD | IC | NC | ND1 | ND2 | NI | NR | PN | PR | DF | Reference |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| B. tabuleiro (one note) | 3 males 34 calls | 0.037 ± 0.01 (0.028–0.062) n = 34 | 6.52 ± 2.0 (2.07–11.25) n = 33 | 1 | 0.037 ± 0.01 (0.028–0.062) n = 34 | — | — | — | 3 ± 0.34 (2–4) n = 34 | 75.8 ± 13.9 (54.1–107.1) n = 34 | 6,399 ± 103.4 (6,115-6,546) n = 34 | This work |
| B. tabuleiro (two notes) | 1 male 10 calls | 0.568 ± 0.20 (0.541–0.628) n = 10 | 11.31 ± 1.55 (10.03–13.94) n = 8 | 2 n = 10 | 0.069 ± 0.006 (0.057–0.075) n = 10 | 0.058 ± 0.006 (0.050–0.071) n = 10 | 0.436 ± 0.027 (0.415–0.507) n = 10 | 3.53 ± 0.14 (3.18–3.70) n = 10 | 3.50 ± 0.51 (3–4) n = 20 | 55.10 ± 4.07 (47.62–65.57) n = 20 | 6,136.9 ± 61.70 (6,115–6,373) n = 10 | This work |
| B. actaeus | 6 males | 0.04 ± 0.01 (0.030–0.040) n = 110 | 5.42 ± 1.83 (3.27–7.68) n = 104 | 1 | 0.04 ± 0.01 (0.03–0.04) n = 110 | — | — | — | (2–3) | 0.42 ± 0.15 (0.26–0.63) n = 229 | 6,900 ± 0.3 (6,600–7,300) n = 110 |
|
| B. albolineatus* | 20 males 34 calls | 88.37 ± 35.73 (39.93–191.14) | — | 17.26 ± 6.38 (8–29) | 0.020 ± 0.007 (0.002–0.037) n = 96 | — | — | 686.4 ± 3.22 (353.4–1085.4) | 2.0 ± 0.59 (1–3) n = 323 | — | 6,380 ± 0.30 (5,340–7,320) |
|
| B. bufonoides* | 3 males 3 calls | ~180.0 | — | — | 0.271 ± 0.02 (0.222–0.308) n = 352 (0.222–0.308) n = 352 | — | 0.209 ± 0.02 (0.147–0.265) n = 298 | 2.15 ± 0.20 (1.98–2.43) n = 3 | 15.05 ± 0.88 (13–17) n = 352 | 56.20 ± 4.81 (47.55–71.28) n = 352 (47.55– 71.28) n = 352 | 4,550 ± 0.001 (4,130–4,880) n = 344 |
|
| B. crispus | 5 males 100 calls | 0.280 ± 0.02 | 0.350 ± 20 (0.122–0.215) | 1 | 0.280 ± 0.02 | — | 0.350 ± 20 (0.122–0.215) | (1.67 ± 0.09) | 10 ± 1.19 (7–12) | 17.4 ± 2.1 | 4,600 ± 0.2 (3,500–5,700) |
|
| B. darkside* | 5 males 1025 calls | 30.4 ± 25.3 (2.9–66.2) n = 7 | 6.2–11.2 n = 2 | 114 ± 97.1 (9–253) n = 7 | 0.111 ± 13.7 (0.083–0.163) | — | 0.159 ± 14.5 (0.122–0.215) n = 783 | 0.211 ± 25.6 (0.186–0.243) n = 5 | 6.3 ± 0.7 (5–8) n = 790 | 56.9 ± 4.9 (36.8–78.4) n = 790 | 3,382.1 ± 184.6 (2,856–3,796) n = 790 |
|
| B. ephippium* | — | 120 – 360 | 0.134 ± 6.8 | — | 0.112 ± 6.5 (0.093–0.125) | — | (0.134 ± 6.8) | — | 12 ± 1.96 (5–15) | — | (3,400– 5,300) |
|
| B. hermogenesi* | 31 males 1549 calls | (0.200–1.900) n = 27 | — | — | — | — | — | 1.09 | (4–5)** | — | 6,800 ± 0.8 n = 5 |
|
| B. ibitinga | 2 males 48 calls | 0.22 ± 0.02 (0.18–0.25) n = 48 | 0.32 ± 0.03 (0.28–0.37) n = 46 | 1 | 0.22 ± 0.02 (0.18–0.25) n = 48 | — | 0.32 ± 0.03 (0.28–0.37) n = 46 | 1.85 n = 48 | 10 ± 1 (8–12) n = 48 | — | 4,100 ± 0.06 (4,000–4,300) n = 48 |
|
| B. mirissimus* | 12 males 31 calls | 111.83 ± 46.6 (37.70–255.20) | — | 23.55 ± 10.29 (6–52) | 0.010 ± 0.007 (0.002–0.027) n = 115 | — | — | 701.4 ± 2.12 (448.8–95.8) | — | — | 6,660 ± 0.28 (6,000–7,230) |
|
| B. olivaceus | 3 males 27 calls | 0.04 ± 0.01 (0.030–0.050) | 10.69 ± 4.56 (7.92–19.66) | 1 | 38 ± 7 (0.030–0.050) | — | 1.068 ± 456 (0.792–1.966) | 0.12 ± 0.03 (0.07–0.16) | 2 ± 0 (2–3) | 0.26 ± 0.10 (0.14–0.41) | 6,800 ± 0.2 (6,400–7,000) |
|
| B. pernix | — | 0.060 | 0.140 | — | 0.060 | — | 0.140 | — | 3 | — | (4,500–6,700) |
|
| B. pitanga | 14 males 6 calls | 0.170 ± 13.0 | — | — | 0.170 ± 13.0 | — | — | 2.65 ± 0.2 | (11.1 ± 1.2) | (62 ± 8) | 4,900 ± 0.2 |
|
| B. quiririensis | 5 males 48 calls | 0.05 ± 0.00 (0.040–0.050) | 12.58 ± 1.38 (10.90–14.31) | 1 | 0.050 ± 4.0 (0.040–0.050) | — | 1.258 ± 138 (1.090–1.431) | 0.08 ± 0.01 (0.07–0.11) | 3 ± 0 (3–4) | 0.30 ± 0.08 (0.20–0.44) | 6,300 ± 0.2 (6,200–6,500) |
|
| B. rotenbergae* | 5 males 204 calls | (120–360) n = 204 | 0.15 ± 0.03 (0.11–0.25) n = 198 | — | (0.09–0.24) n = 204 | — | 0.15 ± 0.03 (0.11–0.25) n = 198 | 3.07 ± 0.46 (2.50–3.48) | (5–15) n = 204 | 60.09 ± 3.71 (50.56–71.82) | 3,830 ± 0.35 (3,040–5,300) |
|
| B. sulfuratus | 11 males 95 calls | 1.8 ± 0.2 (1.5–2.3) | 4.5 ± 1.7 (3.1–7.4) | (5–6) | 0.195 ± 13 (0.131– 0.233) | — | — | — | 5.3 ± 0.9 (4–7) | 0.2 ± 0.0 (0.1–0.3) | 6,700 ± 0.3 (6,200–7,200) |
|
| B. tridactylus | 17 males | 0.110 ± 0.0 | — | — | 0.110 ± 0.0 | — | — | 0.16 ± 0.03 | 1–3*** | — | 4,800 ± 0.2 |
|
Body robust, “bufoniform”; head wider than long, head length 20% of SVL; snout short, rounded in dorsal and lateral views; nostrils elliptical and protuberant; canthus rostralis distinct and straight; loreal region slightly concave; eyes oriented anterolaterally; eye diameter 52% (range) of head length; tympanum absent; lips nearly sigmoid; vocal sac not expanded externally; elongated vocal slits; tongue elliptic, longer than wide, with the posterior half not adherent to floor of mouth; vomerine teeth absent; choanae small and rounded, anterior to eyes, separated from each other. Arm and forearm moderately slender; hands with fingers I and IV greatly reduced, represented externally by a small lump; finger II reduced but distinct, and finger III larger and robust; fingertips I, II, and III rounded; finger lengths IV < I < II < III; subarticular tubercles absent; inner and outer metacarpal tubercles absent. Legs relatively short, moderately robust; thigh length 34% (range) of SVL, tibia length 92% (range) of thigh length; toes I and V present but externally indistinguishable, toe II greatly reduced, toe III short and distinct, and toe IV larger and robust; toe lengths II < III < IV; tips of the toes II, III, and IV rounded; subarticular tubercles absent; inner and outer metatarsal tubercles absent. Skin on top of the head smooth; dorsal body rough and without dermal co-ossification. Skin on dorsolateral and dorsal surfaces of legs rough; dorsal surface of arms smooth. Ventral surface of the skin is rough, evenly across the body.
SVL 10.40; HL 2.09; HW 4.29; ND 0.18; IND 1.12; ED 1.08; IOD 2.48; END 0.48; THL 3.50; TBL 3.22; FL 3.87; UAL 1.63; FAL 2.54; HAL 1.91.
General dorsal body color olive green, with a thin the vertebral stripe white margined of brown blotches; head is orange scattered with olive green, gray, and brown colors; legs are green gradually changing to an orange color on the knees, heels, and toes; arms and hands are orange, spotted brown; fingers are orange. In lateral view, the head is mostly orange, with eye and naris contour, and the upper lip brown. In ventral view, the general background color is orange; dark olive green blotches are present on the throat, cloacal region, and side of the body, extending toward the dorsum (Figs
After seven years in preservative, general dorsal body color dark brown, with the head and the vertebral stripe light gray; legs brown gradually fading to a cream color on the knees and heels; arms and hands cream, spotted brown, with elbows cream; fingers and toes are cream. In lateral view, head is mostly cream, with eye and naris contour, and the upper lip brown. In ventral view, general background color is cream; brown blotches are present on the throat, cloacal region, and side of the body, extending toward the dorsum; irregular brown spots are distributed on the belly, legs, fingers, and toes (Fig.
The Skull is slightly wider than long in dorsal view, without hyperossification. Premaxillae broad, not fused medially, reduced odontoids present in par dentalis; alary process distinct, taller than wide and separated of nasals; posteromedial process distinct, posteromedial process reduced. Maxillae elongated and arched with reduced odontoids in par dentalis; par facialis reduced with anterior region smaller than the posterior one; preorbital processes distinct, long and anterodorsally oriented; the pars palatine extend from the anterior tip of the maxilla to the base of the posterior process and presents the anterior third larger than the posterior one. The quadratojugals is present, slender, with the maxillary process pointed. Nasals widely separated medially and presents an irregular trapezoidal shape in dorsal view; nasals and sphenethmoid fused, the paraorbital process is absent. Frontoparietals paired, not fused, rectangular shaped, frontoparietal fontanelle roofed; anteriorly the frontoparietals overlap the posterior margin of the sphenethmoid. Vomers cartilaginous and reduced with the prechoanal and postchoanal process ossified. Frontoparietals, prootics, and exoccipitals fused. Neopalatines absent. Parasphenoid is cross-shaped without ornamentation; the cultriforme process is broad and touches the sphenethmoid; lateral alary processes are long. Squamosal is T-shaped in lateral view; the anterior zygomatic ramus is short, with approximately 1/4 of posterior otic ramus length and expanded dorsoventrally at its anterior margin; posterior ramus is approximately at same length of the ventral ramus and projected posterodorsally. The ventral ramus is large and slightly expanded ventrally. The lateral surface of the ventral process is flat; the lamina alaris in the bases of the anterior processes is concave. The pterygoids are slender and T-shaped; the tips of the anterior and posterior ramus are acuminated, tips of the medial ramus are truncated; the anterior ramus is the longest and does not articulate with the maxilla; the posterior ramus is shortest and articulating with the ventral ramus of the squamosal; the short and broad medial ramus articulating with the prootic; the anterior and medial ramus form a straight margo orbitalis. The exoccipitals, and prootics are fused, these bones form the posterior part of the skull; each paired occipital condyle has a marked base and a distal, rounded head. Operculum not ossified. Tympanic annulus and columellae absent. Mandible elongated and edentate, compound by a large angulosplenial, by a reduced cartilaginous dentary and a small mentomecklian cartilage. The Hyoid apparatus is formed by the central corpus, by the hyale anteriorly, by the posterlateral process and by an ossified posteromedial processes; the corpus hyoid is cartilaginous, rectangular and longer than wide; the cartilaginous hyale are long and project anteriorly from the anterolateral margins of the corpus hyoid; a long anterior process of hyale is present; the alary processes of the hyoid are poorly developed; the posterolateral process is short and triangular; the posteromedial processes are long, well ossified, the proximal and distal ends of the posteromedial processes are wider. The pectoral girdle is arciferal, composed by the fusion of the clavicle, coracoid, and scapula; epicoracoid completely ossified and fused with the coracoid; the procoracoid cartilages are continuous with the epicoracoid medially and are partially ossified. Suprascapula fused with coracoid and scapula; sternum and omosternum are not present. Skeleton without hyperossification. Vertebral column composed of eight presacral, procoelous and nonimbricate vertebrae; dorsal ossification of neural arches is complete; the atlas does not present transverse process that is present in all other presacral vertebrae; the relative lengths of the transverse processes in descending order are: III > IV > V > II > VI > VII > VIII; neural spines are not evident. The sacral diapophyses extend posterolaterally and are expanded distally. The distal ends of the sacral diapophyses are cartilaginous and overlie the anterior ends of the ilial shafts. The urostyle is long and slender with approximately 2/3 of the length of the presacral, the urostyle presents a dorsal longitudinal ridge that is higher anteriorly and decreases in height posteriorly. Pelvic girdle V-shape in dorsal view, composed by a fused ilium, pubis, and ischium; each ilial shaft has a low longitudinal crest that decreases in height in the anterior third. The acetabulum is completely ossified with well-defined margins. Forelimbs with humerus slightly curved, with a small crest at the proximal end of the ventral surface; radius and ulna with sulcus intermedius distinct. Manus with distal carpals 3-4-5 and distal carpal 2 presents; radiale and ulnare about the same size; prepollex elements very reduced with one prepollical element; phalangeal formula 1-2-3-1; tips of the terminal phalangeal elements arrow-shaped in fingers I–III, rounded in finger IV. Hindlimbs with tibia and fibula fused; femur and tibiofibula of approximately the same length; fibulare and tibiale fused distal and proximally but separated in the middle portion. Pes with distal tarsal 2–3 and distal tarsal 1 presents; phalangeal formula 1-2-3-4-0. Tips of the terminal phalangeal elements arrow-shaped in toes II–IV, rounded in toes V (Fig.
The advertisement call of Brachycephalus tabuleiro sp. nov. is characterized by one multipulsed note (76.2% of all calls, n = 34), or in a sequence of two multipulsed notes (23.8% of all calls, n = 10; Fig.
Advertisement calls of Brachycephalus tabuleiro recorded at Serra do Tabuleiro, São Bonifácio municipality, Santa Catarina state, Brazil. (A) Call sequence of three calls with only one note each, (B) the spectrogram and (C) oscillogram of one highlighted call (CASA 154). (D) Call sequence of three calls with two notes each, (E) the spectrogram and (F) oscillogram of one highlighted call (with two notes) (CASA 157).
The general dorsal body color varies from a dark olive green to a lighter green with some shades of yellow; the vertebral stripe can be well marked with an orangish line spotted with gray and brown colors, with some individuals exhibiting an irregular gray vertebral stripe (not well marked as a continuous and thin line). The head is orange scattered with olive green and brown colors, and some individuals present the head almost completely orange with few gray blotches and without the green color. The ventral background is orange, with some individuals presenting this region with green reticulated spots (Fig.
Our tree topology (Fig.
Mean uncorrected (p distance) of Brachycephalus tabuleiro sp. nov. to other species of the genus.
| Species | p distance | Species | p distance | Species | p distance |
| B. actaeus | 0.030 | B. garbeanus | 0.164 | B. sp. Apiai | 0.075 |
| B. aff. brunneus | 0.066 | B. izecksohni | 0.060 | B. sp. Camapua | 0.054 |
| B. aff. ephippium | 0.153 | B. leopardus | 0.063 | B. sp. Caratuval | 0.075 |
| B. aff. nodoterga | 0.161 | B. mariaterezae | 0.011 | B. sp. Faz. Thalia | 0.075 |
| B. aff. pernix | 0.015 | B. mirissimus | 0.051 | B. sp. Mae Catira | 0.056 |
| B. albolineatus | 0.046 | B. nodoterga | 0.161 | B. sp. Morro do Canal | 0.056 |
| B. alipioi | 0.155 | B. olivaceus | 0.011 | B. sp. Morro do Vigia | 0.054 |
| B. auroguttatus | 0.011 | B. pernix | 0.013 | B. sp. Morro dos Perdidos | 0.063 |
| B. boticario | 0.043 | B. pitanga | 0.157 | B. sp. Serra das Canasvieias | 0.057 |
| B. brunneus | 0.058 | B. pombali | 0.010 | B. sp. Serra do Salto | 0.054 |
| B. coloratus | 0.011 | B. quiririensis | 0.018 | B. sp. Tupipia | 0.056 |
| B. didactylus | 0.163 | B. rotenbergae | 0.154 | B. toby | 0.161 |
| B. ephippium | 0.157 | B. sp.n. | 0.155 | B. tridactylus | 0.062 |
| B. ferruginus | 0.010 | B. sp. Corvo | 0.078 | B. verrucosus | 0.014 |
| B. fuscolineatus | 0.047 | B. sp. Abrigo | 0.054 | B. vertebralis | 0.159 |
Brachycephalus tabuleiro is diurnal. We found all specimens on the forest floor amidst leaf litter (0–70 mm under surface, n = 9 individuals). Males calling on the leaf litter, below one or more dry leaves (n = 3 individuals) or upside down (n = 1 individual). One female was found on leaf litter nearby and turned towards a male calling. We observed greater intensity and abundance of vocalization at the beginning of the day (7 a.m.) and at the end of the afternoon (18 p.m.) (dawn/dusk). On days with rain or intense cloudiness, males appear to be active throughout the day. However, on sunny days, at warmer times (10 a.m. to 4 p.m.), the vocal activity and abundance of vocalizing males decreases or neither occurs. We recorded two potentially defensive behaviors for males and females: the mouth-gaping (Fig.
Brachycephalus tabuleiro is known from one locality in São Bonifácio municipality, to the Parque Estadual da Serra do Tabuleiro, a protected area in Santa Catarina state, Brazil (Fig.
Geographic distribution of Brachycephalus tabuleiro and of the more closely related species within the B. pernix group, formed by: B. actaeus, B. albolineatus, B. auroguttatus, B. boticario, B. coloratus, B. ferruginus, B. fuscolineatus, B. mariaterezae, B. mirissimus, B. olivaceus, B. pernix, B. pombali, B. quiririensis, and B. verrucosus.
The species is named for the type locality in the Serra do Tabuleiro. The Parque Estadual da Serra do Tabuleiro is the largest remnant of the Atlantic Rainforest in southern Brazil.
There is significant anthropogenic interference around the type locality of the new species, both in and around the Parque Estadual da Serra do Tabuleiro. The type locality is beside a dirt road, at the park boundaries (Fig.
Montane frogs generally exhibit considerable levels of endemism (
In the last decade, the number of described species of Brachycephalus has rapidly increased (n =23, which represents 61% of the total species of the genus). This has been accompanied by the use of several lines of evidence, providing molecular support for delimiting species (e.g.,
Brachycephalus tabuleiro has the skull completely roofed, however, the suture of the frontoparietals is present. Among the species of the B. pernix group with some osteological study, the suture of frontoparietals can be observed in B. brunneus (
Advertisement calls of Brachycephalus tabuleiro is very similar to B. actaeus, differing basically by lower dominant frequency and for generally to emit calls with three pulses while in B. actaeus is more common with two pulses (
Compare the morphology and advertisement call among Brachycephalus species is difficult, once the studies used nonstandard features (e.g., different terms for the same category, such as “rough”, “granular” and “rugose”, for skin texture) and different terminologies of the acoustic parameters or even different parameters to describe the calls (for instance,
The Atlantic Forest is an important hotspot of biodiversity, currently with less than 12% of forest cover remaining, with the greatest extent area located in its southern distribution (
We thank partial grants PPBio (Programa de Pesquisa em Biodiversidade – PPBio – CNPq process 457524/2012-0) for financial support. We thank C. Kraus for helping in logistic support in the field, B. Cesário and D.C. Passos for helping during field surveys. We thank J.P. Pombal Jr., J.C. Moura-Leite, M.R. Pie, and L.F. Ribeiro for allowing access to preserved specimens under their care. We thank C.M. da Silva, M. Hrncir and L.E.L Melo for access to stereomicroscope camera to take pictures of specimens. DJS thanks CNPq (Conselho Nacional de Desenvolvimento Científico e Tecnológico) for his research fellowship (309420/2020-2). This study was conducted with appropriate permissions and guidelines from the responsible authority (licenses 33507-1/41748 and 043/2014/GERUC/DPEC) issued by “Instituto Chico Mendes de Conservação da Biodiversidade” (ICMBio) and Fundação do Meio Ambiente (FATMA)/Instituto do Meio Ambiente de Santa Catarina (IMA-SC)”, respectively, that also evaluated protocols for our collection and research).
Brachycephalus actaeus. BRAZIL — Santa Catarina • 3; São Francisco do Sul; Topotype; MHNCI 10832–34.
Brachycephalus albolineatus. BRAZIL — Santa Catarina • 1; Jaraguá do Sul/Massaranduba; Holotype; MHNCI 10290 • 2; same collection data as for preceding; Paratopotypes; MHNCI 10297/10299.
Brachycephalus auroguttatus. BRAZIL — Santa Catarina • 1; Garuva; Holotype; MHNCI 10200 (DZUP 375) • 9; same collection data as for preceding; Paratypes; MHNCI 10198 to199 (DZUP 373 to 74)/10202 (DZUP 377)/10204 (DZUP 379)/10207 to 208 (DZUP 382 to 83)/10212 to 214 (DZUP 387 to 89).
Brachycephalus boticario. BRAZIL — Santa Catarina • 1; Blumenau; Holotype; MHNCI 10257 (DZUP 440) • 2; same collection data as for preceding; Paratypes; MHNCI 10253 (DZUP 414)/10731 (DZUP 458).
Brachycephalus brunneus. BRAZIL — Santa Catarina • 3; Campina Grande do Sul; MNRJ 40289 to 40291.
Brachycephalus coloratus. BRAZIL — Paraná • 1; Piraquara; Holotype; MHNCI 10273 • 2; same collection data as for preceding; Paratypes; MHNCI 10276/10278 • 2; same collection data as for preceding; MNRJ 89949 to 89950 (DZUP 505 to 506).
Brachycephalus curupira. BRAZIL — Paraná • 1; São José dos Pinhais; Holotype MHNCI 10280 • 2; same collection data as for preceding; Paratypes MHNCI 10282/10287.
Brachycephalus fuscolineatus. BRAZIL — Santa Catarina • 1; Ilhota; Holotype; MHCNI 10231 (DZUP 159) • 2; same collection data as for preceding; Paratypes; 10234 (DZUP 402)/10236 (DZUP 404).
Brachycephalus leopardus. BRAZIL — Paraná • 3; Tijucas do Sul; Paratypes; MHCNI 10245 to 10246 (DZUP 485 to 486)/10251 (DZUP 491).
Brachycephalus mariaterezae. BRAZIL — Santa Catarina • 1; Joinville; Holotype; MHNCI 9811 (DZUP 168) • 5; same collection data as for preceding; Paratypes; MHNCI 10190 (DZUP 372)/10192 (DZUP 394)/10194 (DZUP 396)/10196 to 10197 (DZUP 398 to 399).
Brachycephalus mirissimus. BRAZIL — Santa Catarina • 1; Massaranduba; Holotype; MHNCI 10793.
Brachycephalus olivaceus. BRAZIL — Santa Catarina • 1; Joinville; Holotype; MHNCI 9813 (DZUP 170) • 5; same collection data as for preceding; Paratypes; MHNCI 9815 to 9818 (DZUP 164 to 167) • 1; same collection data as for preceding; Paratopotype; MHNCI 10238 (DZUP 371).
Brachycephalus pernix. BRAZIL — Paraná • 1; Quatro Barras; Holotype; MNRJ 17349 • 3; same collection data as for preceding; MHNCI 10231/10234/10236.
Brachycephalus pombali. BRAZIL — Paraná • 3; Morretes; DZUP 213–215.
Brachycephalus quiririensis. BRAZIL — Santa Catarina • 3; Campo Alegre; Paratopotypes; MHNCI 10264 to 10265 (DZUP 175 to 176)/10267 (DZUP 525).
Brachycephalus tabuleiro. BRAZIL — Santa Catarina • 1; São Bonifácio; Holotype; MNRJ 93859 • 13, Paratypes; MHNCI 11498, CFBH 45453, CHSA.A 1403, MNRJ 93854–55, UNIFESSPA 112, ZUFMS-AMP 14532, CHSA.A 1404, MHNCI 11499; • 5 adults not sexed, collected at the type locality; CFBH 45452, MNRJ 93856–58, ZUFMS-AMP 14531.
Brachycephalus tridactylus. BRAZIL — Paraná • 3; Guaraqueçaba; MHNCI 10187/10294/10729.
Brachycephalus verrucosus. BRAZIL — Santa Catarina • 1; Joinville; Holotype; MHNCI 9819 (DZUP 161) • 4; same collection data as for preceding; MHNCI 10216 (DZUP 465)/10222 to 10224 (DZUP 471 to 473).
Table S1
Data type: .xlsx
Explanation note: GenBank accession numbers for 16S gene of specimens included in the molecular analyses.
Table S2
Data type: .docx
Explanation note: Uncorrected p distances for a 523-bp aligned sequence of the 16S gene of the new species and 45 other Brachycephalus species (or candidate species) taken from GenBank.