Research Article |
|
Corresponding author: Miquéias Ferrão ( uranoscodon@gmail.com ) Academic editor: Raffael Ernst
© 2023 Jesus R. D. Souza, Miquéias Ferrão, Igor Luis Kaefer, Antonio Saulo Cunha-Machado, Paulo Roberto Melo-Sampaio, James Hanken, Albertina Pimentel Lima.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Souza JRD, Ferrão M, Kaefer IL, Cunha-Machado AS, Melo-Sampaio PR, Hanken J, Lima AP (2023) A new pale-ventered nurse frog (Aromobatidae: Allobates) from southwestern Brazilian Amazonia. Vertebrate Zoology 73: 647-675. https://doi.org/10.3897/vz.73.e103534
|
Abstract
We use integrative taxonomy to formally describe a candidate species of nurse frog of the genus Allobates from southwestern Brazilian Amazonia. The new species nests within a clade that has been defined historically as A. gasconi, but it has an 8.8–11.0% genetic distance for 16S to samples from the type locality of A. gasconi. The new species differs from congeners mainly by males having a translucent white throat and vocal sac; advertisement calls with a duration of 42–60 ms, two notes separated by an inter-note interval of 8–23 ms, and a dominant frequency of 4,953–6,331 Hz; and exotrophic tadpoles with 2 pyramidal papillae on each end of the upper lip and 10–13 pyramidal and cylindrical papillae surrounding the lower lip. Phylogenetic analyses based on mitochondrial DNA suggest that A. gasconi sensu lato as defined previously represents a complex of as many as seven species, corroborating studies that have shown high levels of cryptic diversity within Allobates.
Advertisement call, biodiversity, integrative taxonomy, morphology, phylogeny, reproductive behavior, State of Acre, tadpole
Nurse frogs of the genus Allobates Zimmermann & Zimmermann, 1988 are leaf-litter inhabitants of neotropical forests distributed from Central America to the east coast of South America (
Advertisement calls may be classified into two main types following the note-centered approach (sensu
The recent increase in the understanding of taxonomic diversity of Allobates is impressive: at least thirteen species have been described in just the last five years (
Allobates gasconi was described based on the morphology of 33 individuals from five localities along both banks of the Juruá River, southwestern Brazilian Amazonia (
We recently surveyed multiple localities in southwestern Amazonia (Acre, Brazil). Among the material collected are several individuals of Allobates gasconi sensu lato that nest within a previously reported lineage by
Adult individuals were collected between November 2018 and February 2020 from five localities in southwestern Brazilian Amazonia—four in the State of Acre (forest fragment near the BR 364 highway, municipality of Manoel Urbano [8°52’27”S, 69°17’07”W, 166 meters above sea level—hereafter m asl]; east bank of the Antimary River, municipality of Bujari [09°29’16”S, 68°21’20”W, 168 m asl]; Parque Ambiental Chico Mendes, municipality of Rio Branco [10°02’13”S, 67°47’36”W, 158 m asl]; and municipality of Feijó [08°14’13”S, 70°22’44”W, 184 m asl]) and a fifth in the State of Amazonas (Reserva Extrativista Arapixi, municipality of Boca do Acre [08°58’21”S, 67°51’50”W, 125 m asl]). Ten tadpoles (INPAH45066) were taken from the dorsum of a male (INPAH45045) collected in Manoel Urbano on January 18, 2020; 18 eggs were taken from a freshly laid spawn (field number APL21511b) on January 7, 2020.
Tadpoles and eggs were reared in the laboratory until they reached
Advertisement calls of 17 males were recorded: eight from Manoel Urbano, two from Antimary River, three from Parque Ambiental Chico Mendes, one from Feijó and three from Reserva Extrativista Arapixi. Recordings were made between 0630 and 1100 h and between 1500 and 1730 h using a Sony PCM-D50 digital recorder with built-in microphone, a CSR Yoga HT-81 Shotgun directional microphone attached to a Zoom H4n recorder, and a Sennheiser ME 66 unidirectional microphone attached to a Marantz PMD661 digital recorder. Microphones were positioned approximately 1 m from the focal male. Recordings were taken at 16-bit resolution and 44.1 kHz and stored in WAV format. Air temperature recorded at the time of recordings ranged from 21 to 29°C. Recordings are deposited in the Fonoteca Neotropical Jacques Vielliard (FNJV 53680–93), UNICAMP, Campinas, Brazil.
Total genomic DNA was extracted from tissue samples of five individuals of the new species from Manoel Urbano, two from Antimary River and two from Parque Ambiental Chico Mendes (Rio Branco). DNA extractions were obtained using the commercial kit Wizard (Promega Corp., Madison, WI, USA) following manufacturer’s instructions. Fragments of the 16S rRNA mitochondrial gene were amplified by polymerase chain reaction (PCR) using the universal primers 16sar (CGCCTGTTTATCAAAAACAT) and 16sbr (CCGGTCTGAACTCAGATCACGT;
Sequences of the 16S fragment and four additional genes (12S ribosomal RNA [12S], cytochrome c oxidase I [COI], cytochrome B [cyt b] and NADH dehydrogenase 1 [ND1]) were retrieved from GenBank to infer the phylogenetic relationship of the new species, including sequences of five individuals of the new species previously reported as A. gasconi by
The final matrix was split into 10 partitions, one for RNA genes (12S plus 16S) and one for each codon of protein-coding genes (COI, cyt b and ND1). The following best-fit partitioning scheme and nucleotide models were inferred with MODELFINDER (
We conducted three molecular species delimitation analyses to delimit putative species: Generalized Mixed Yule Coalescent (GMYC;
Molecular species delimitation analyses were conducted with the complete 16S alignment, which include all other species of Allobates included in previous phylogenetic analyses. GMYC requires a single-locus ultrametric phylogenetic tree as input, therefore a 16S tree was inferred through Bayesian Inference in BEAST 2.6.3 (
Sex was determined by the presence of a vocal sac or direct observation of vocal activity in males, and by the presence of eggs (visible through belly skin) in females. The following linear measurements, taken using a digital calipers (precision 0.01 mm) or a stereomicroscope (precision greater than 0.1 mm), follow
Developmental stage was scored according to
Although body size may be informative in some interspecific pair-wise comparisons, statistical artifacts are eventually associated with the use of raw body ratios (all measurements against SVL) in standard Principal Component Analysis (PCA), thus we ran an adapted PCA called Shape PCA (
Presence of sexual dimorphism in SVL and 22 morphometric ratios of the new species was evaluated with one-way ANOVAs through the function aov of the package stats (
Terminology used to describe the advertisement call of the new species follows the note-centered approach (
Notes on reproductive behavior were obtained from observation of four courtship events that occurred between 0600 and 0900 h: one in Manoel Urbano on February 7, 2020; the other three in Parque Ambiental Chico Mendes on February 12, 14 and 15, 2020. The courting male INPAH45044 and female INPAH45050 were collected; both are included in the type series.
The new species has been found only in the upper Juruá and Purus basins, southwestern Brazilian Amazonia. Since most Allobates have restricted geographic distributions when compared to species in other genera, interspecific comparisons here are limited to cryptically colored species known to be distributed in the southwestern Amazonian lowlands of Bolivia, Brazil and Peru (Appendix
Geographic distribution of the new species (yellow symbols): Type locality = star (1 Manoel Urbano), paratype localities = circles (2 Antimary River; 3 Parque Ambiental Chico Mendes) and additional localities = rhombus (4, Feijó; 5, Reserva Extrativista Arapixi). Type localities of other Allobates to which it is compared (squares): 6 A. subfolionidificans; 7 A. flaviventris; 8 A. tinae; 9 A. gasconi (red square); 10 A. vanzolinius; 11 A. fuscellus; 12 A. velocicantus; 13 A. conspicuus; 14 A. ornatus; 15 A. trilineatus; 16 A. sieggreenae; 17 A. melanolaemus; 18 A. caeruleodactylus; 19 A. nidicola; 20 A. paleovarzensis; 21 A. grillisimilis; 22 A. tapajos; 23 A. grillicantus; 24 A. pacaas; 25 A. paleci; 26 A. kamilae. Abbreviations: BOL, Bolivia; COL, Colombia; ECU, Ecuador; PER, Peru.
The topology of our molecular phylogeny is consistent with that recovered in the most recently published phylogeny of Allobates (
Phylogeny of Allobates based on five mitochondrial genes (12S, 16S, COI, cyt b and ND1), focusing on relationships within the Allobates caeruleodactylus clade. Node support was calculated following 10,000 ultrafast bootstrap approximation replicates and 10,000 replicates of the SH-aLRT branch test. Vertical bars represent species delimited with 16S through Automatic Barcode Gap Discovery (ABGD), Assemble Species by Automatic Partitioning (ASAP) and Generalized Mixed Yule Coalescent (GMYC) methods. The phylogenetic tree inset at lower left indicates the location of the A. caeruleodactylus clade in the overall Allobates phylogeny (Supplemental Figure
Within the species complex that groups species previously misidentified as Allobates gasconi, newly sequenced individuals of the new species (A. albiventris sp. nov.) cluster together in a highly supported group with individuals from Feijó, Reserva Extrativista (RE) Arapixi and Parque Ambiental (PA) Chico Mendes (Acre and Amazonas, Brazil) reported by
Interspecific pairwise p distances within the Allobates albiventris species complex range from 1.2 to 4.8% (Table
Pairwise genetic distances between and within Allobates gasconi sensu stricto (SS) and species of the Allobates albiventris species complex based on a fragment of 16S rRNA. Uncorrected pairwise distances (p distance) and Kimura 2-parameter distances (K2P) are below and above the diagonal, respectively. Numbers in bold along the diagonal denote intraspecific p distances. Distances are expressed as percentage and presented as mean and range.
| Species | 1 | 2 | 3 | 4 | 5 | 6 | |
| 1 | A. gasconi SS | 0.4 (0.0–0.9) | 10.2 (9.0–12.1) | 9.6 (8.8–11.0) | 10.2 (9.0–11.8) | 10.9 (9.5–12.3) | 10.7 (9.3–12.6) |
| 2 | A. aff. albiventris SL1 | 9.5 (8.4–11.1) | 0.1 (0.0–0.2) | 3.1 (2.8–3.3) | 4.8 (4.6–5.0) | 4.1 (3.8–5.0) | 4.5 (4.0–5.0) |
| 3 | A. aff. albiventris SL2 | 9.0 (8.3–10.1) | 3.0 (2.8–3.2) | 0.2 (0.0–0.6) | 3.8 (3.7–4.1) | 3.3 (2.8–4.3) | 3.9 (3.5–4.4) |
| 4 | A. aff. albiventris SL3 | 9.5 (8.5–10.8) | 4.6 (4.4–4.8) | 3.7 (3.6–3.9) | 0.2 (0.0–0.4) | 1.9 (1.6–2.2) | 2.3 (1.7–2.9) |
| 5 | A. albiventris sp. nov. | 10.0 (8.8–11.0) | 4.0 (3.8–4.8) | 3.2 (2.9–4.1) | 1.9 (1.6–2.1) | 0.2 (0.0–0.4) | 2.0 (1.2–2.5) |
| 6 | A. aff. albiventris SL5 | 9.9 (8.7–11.4) | 4.3 (3.8–4.8) | 3.7 (3.4–4.2) | 2.2 (1.7–2.8) | 2.0 (1.2–2.4) | 0.6 (0.0–1.6) |
The best-ranked partition computed by ASAP (score = 3.5; p = 0.001; w = 0.0006) delimits all five clades within the species complex as distinct species (Fig.
The first two principal components of the Shape PCA performed with 23 morphometric measurements of A. gasconi sensu stricto and the new species together explain 64.6% and 63.1% of the variance of males and females, respectively (Table
Loadings of morphometric variables on the first two shape principal components (PC) based on 28 male and 22 female Allobates gasconi sensu stricto and Allobates albiventris sp. nov. Numbers in bold denote variables that make the highest contributions to each shape PC. Measurement acronyms are described in the text; n, sample size.
| Variables | Males | Females | ||
| shape.PC1 | shape.PC2 | shape.PC1 | shape.PC2 | |
| DPT | –0.047 | –0.203 | –0.088 | –0.067 |
| EL | –0.043 | 0.029 | 0.048 | 0.071 |
| EN | 0.415 | –0.008 | 0.335 | –0.026 |
| FAL | 0.073 | 0.037 | 0.047 | 0.171 |
| FL | 0.137 | 0.147 | 0.115 | 0.071 |
| HANDI | 0.037 | 0.056 | 0.083 | 0.158 |
| HANDII | 0.02 | 0.11 | 0.051 | 0.118 |
| HANDIII | 0.082 | 0.037 | 0.052 | 0.075 |
| HANDIV | 0.038 | 0.103 | 0.06 | 0.091 |
| HL | –0.197 | 0.112 | –0.172 | 0.104 |
| HW | –0.135 | 0.133 | –0.161 | 0.126 |
| IN | 0.082 | 0.007 | 0.032 | 0.07 |
| IO | –0.026 | 0.101 | –0.029 | 0.097 |
| SL | 0.406 | 0.088 | 0.345 | 0.051 |
| SVL | 0.044 | 0.026 | 0.039 | 0.054 |
| THL | 0.03 | 0.142 | 0.016 | 0.083 |
| TIL | 0.035 | 0.204 | 0.014 | 0.072 |
| TYM | –0.161 | –0.07 | –0.081 | –0.04 |
| UAL | 0.002 | 0.118 | 0.003 | 0.015 |
| WFD | –0.231 | 0.033 | –0.154 | –0.123 |
| WPF | –0.617 | –0.213 | –0.775 | –0.158 |
| WTD | –0.187 | –0.147 | 0.029 | –0.124 |
| WTT | 0.247 | –0.843 | 0.191 | –0.887 |
Allobates gasconi –
INPAH45035 (field number APL21526), an adult male collected by J.R.D. Souza on February 5, 2020, in a forest fragment near BR 364 (08°52’27”S, 69°17’07”W, 166 m asl), municipality of Manoel Urbano, State of Acre, Brazil.
Nineteen adult specimens collected by J.R.D. Souza and A.P. Lima at the same locality as the holotype: 13 males INPAH45036–40 (field numbers APL21371–75), INPAH45042–47 (field numbers 21479–80, 21511, 21518, 21525 and 21528, respectively) and MPEG44609–10 (field numbers APL21370 and 21380, respectively), and six females INPAH45048–51 (field numbers APL21476, 21481, 21512 and 21527, respectively) and MPEG44611–12 (field numbers APL21478 and 21515, respectively).
Twenty-three adult specimens collected between 2018 and 2020 by J.R.D. Souza in the State of Acre, and between 2015 and 2016 by P.R. Melo-Sampaio in the States of Acre and Amazonas. ACRE: 10 females MPEG44607 (field number APL21355), INPAH45052–59 (field numbers APL21357, 21523–24 and 21530–34, respectively) and MPEG44613 (field number APL21522) and 7 males INPAH45060–63 (field numbers APL21520–21, 21354 and 21356, respectively), MPEG44608 (field number APL21358), MPEG44606 (field number APL21352) and MNRJ91679 (GenBank KY886578) from Parque Ambiental Chico Mendes (10°02’13”S, 67°47’36”W, 158 m asl), municipality of Rio Branco; and 2 males INPAH45064–65 (field numbers APL21350–51, respectively) collected near the bank of the Antimary River (09°29’16”S, 68°21’20”W, 168 m asl.); one female MNRJ91665 (GenBank KY886576) and one male MCP13630 (GenBank KY886577) from the municipality of Feijó (08°14’13”S, 70°22’44”W, 184 m asl). AMAZONAS: one male MNRJ91683 (GenBank KY886574) and one female MNRJ91684 (GenBank KY886575) from Reserva Extrativista Arapixi (08°58’21”S, 67°51’50”W, 125 m asl), municipality of Boca do Acre.
Brazil: Acre, one male (PRMS0360) collected by P.R. Melo-Sampaio on January 25, 2016, in Reserva Extrativista Arapixi, municipality of Boca do Acre.
The specific epithet albiventris is a combination of two Latin words, albus (white) and ventris (venter), in reference to the pale ventral coloration of the new species. Vernacular names: pale-ventered nurse frog (English), rana cuidadora de vientre blanco (Spanish), and rãzinha cuidadora de ventre branco (Portuguese).
The new species is allocated to the genus Allobates based on molecular phylogenetic analysis and phenotypic characters proposed by
Allobates albiventris sp. nov. is characterized by small adult size, SVL 14.3–16.4 mm (n = 22) in males and 15.6–17.8 mm (n = 16) in females. Dorsum smooth with a high concentration of granules in the medium posterior portion. Snout semi-truncated and semi-acuminate in dorsal and lateral views; canthus rostralis almost straight in dorsal view; loreal region flat; nostrils visible in ventral and lateral views. Tympanum diameter 34–48% of EL. Maxillary teeth present, visible under magnification; median lingual process absent. One subarticular tubercle on finger IV; fingers II and III weakly swollen in adult males; disc on finger II approximately the same width as distal phalanx; width of discs on fingers I, III and IV represent 1.3±0.3, 1.5±0.2 and 1.6±0.2 of width of respective distal phalanges; tip of finger IV reaches the distal subarticular tubercle of finger III; nuptial excrescence on thumb absent; lateral keels present on fingers II–IV; supernumerary tubercles and metacarpal ridge absent; webbing absent between fingers; black gland absent on arm; tarsal keel present, tubercle-like, strongly curved towards the inner metatarsal tubercle; basal webbing present between toes II–IV, less developed between toes II and III; discs on toes II–V moderately expanded; disc on toe I not expanded, approximately the same width of distal phalanx; lateral keels present on all toes. Dorsum light brown with a dark brown band, diamond or hourglass-shaped marks; pale dorsolateral stripe present in preserved specimens, with an irregular upper border extending from the posterior region of the eyelids to the posteromedial region of the body or urostyle; pale ventrolateral stripe absent in preservative, discontinued when present in living specimens; dark brown oblique lateral stripe present, narrower from snout to anterior corner of eye, wider from the posterior corner of the eye to the groin, with an irregular lower border. Paired dorsal digital scutes white. Cream-colored forelimbs with scattered dark brown spots and blotches. Hind limbs light brown; anterior and dorsal portions of the thigh with dark brown spots, dorsal region light brown with scattered spots; a dark brown transverse bar present on thigh of some individuals, usually on tibia; comma-shaped, light brown to orange paracloacal mark. In life, males and females have a white belly and chest without melanophores; throat and vocal sac of males translucent white with scattered melanophores; throat white centrally and posteriorly, translucent laterally and anteriorly in females, with scattered melanophores distributed in the anterior region of the maxilla. Unpigmented intestine. Dark brown mature oocyte; unpigmented testes. Advertisement call with a duration of 42–60 ms and comprising two notes (the first note is shorter than the second), with an inter-note interval of 8–23 ms and dominant frequency of 4,953–6,331 Hz. Exotrophic tadpoles with 2 pyramidal papillae on each end of the anterior labium; 10–13 pyramidal and cylindrical papillae on the posterior labium; LTRF = 2(2)/3(1); gap in row A-2 ≈ 40% of A-1; relative length P-1 > P-2 > P-3; and P-3 ≈ 65% of P-1.
Allobates albiventris sp. nov. differs from other Allobates by the following combination of characters: males in life with a throat and vocal sac translucent white with melanophores uniformly distributed and a white belly; females in life with throat white centrally and posteriorly, translucent laterally and anteriorly, chest and belly white; small adult size, SVL 14.3–16.4 mm (n = 22) in males and 15.6–17.8 mm (n = 16) in females; one subarticular tubercle on finger IV; finger III of adult males weakly swollen; disc of finger II approximately the same width as the distal phalanx; interdigital membranes present between toes II, III and IV; paired digital scutes white; advertisement call with a duration of 42–60 ms and comprising two notes (the first note is smaller than the second), with an inter-note interval of 8–23 ms and dominant frequency of 4,953–6,331 Hz; exotrophic tadpoles with 2 pyramidal papillae on each end of the anterior labium, 10–13 pyramidal and cylindrical papillae on the posterior labium, LTRF = 2(2)/3(1), gap in row A-2 ≈ 40% of A-1, relative length P-1 > P-2 > P-3, and P-3 ≈ 65% of P-1.
Characteristics of the compared species are presented within parentheses unless stated otherwise. Males of Allobates albiventris sp. nov. are easily distinguished from those of A. flaviventris, A. fuscellus, A. grillicantus, A. kamilae, A. melanolaemus, A. nidicola, A. ornatus, A. paleci, A. paleovarzensis, A. tapajos, A. tinae, A. trilineatus, A. vanzolinius and A. velocicantus by having a translucent white throat and vocal sac in life (violaceous to gray in A. flaviventris, A. pacaas and A. paleovarzensis; yellow in A. grillicantus, A. kamilae, A. paleci, A. tapajos and A. tinae; gray to black in A. fuscellus, A. melanolaemus, A. nidicola, A. trilineatus and A. vanzolinius; gray in A. ornatus; whitish centrally and yellow laterally in A. velocicantus). Additionally, A. albiventris sp. nov. differs from A. pacaas by having only one subarticular tubercle on finger IV (two tubercles); from A. tapajos by the presence of melanophores on the vocal sac of males (absent); from A. flaviventris, A. nidicola, A. paleovarzensis and A. vanzolinius by having a maximum SVL of 16.4 mm in males (minimum SVL 16.7 mm in A. flaviventris, 18.5 mm in A. nidicola, 18.3 mm in A. paleovarzensis and 21.5 mm in A. vanzolinius).
Males of Allobates caeruleodactylus, A. conspicuus, A. grillisimilis, A. subfolionidificans and A. sieggreenae have a throat and vocal sac coloration similar to A. albiventris sp. nov. However, A. albiventris sp. nov. differs from these species by the presence of dark marks or a dark brown, wide longitudinal band on the dorsum (uniform light brown dorsum in all mentioned species). In addition, A. albiventris sp. nov. differs from A. caeruleodactylus by having white digital scutes in life (blue); from A. conspicuus and A. sieggreenae by the absence of a continuous ventrolateral stripe (ventrolateral stripe present); from A. grillisimilis by having regularly distributed melanophores on the throat, vocal sac and chest (melanophores, when present, only on the jaw); and from A. subfolionidificans by having a dorsolateral stripe (absent) and females in life with a white chest and belly (yellow).
Although A. albiventris sp. nov. has been confused with A. gasconi, they are easily distinguished by the coloration of breeding adults. Males of the new species are easily distinguished from those of A. gasconi sensu stricto by the translucent white throat and vocal sac (gray to dark gray; Fig.
The advertisement calls of Allobates albiventris sp. nov. differ from A. gasconi sensu stricto by a call duration of 50±4 ms (94±33 ms), exclusively composed of 2 notes (2–4 notes, mainly 3 notes) with the first note always shorter than the second (notes with similar duration) and an inter-note interval of 16±4 ms (30±4 ms;
Tadpoles of Allobates albiventris sp. nov. easily differ from those of A. gasconi sensu stricto by having a LTRF = 2(2)/3(1) and a tail highly pigmented with brown spots of various shapes and sizes resembling a marbled pattern (LTRF = 2(2)/2(1) and a tail poorly pigmented with brown spots;
Adult male, INPAH45035 (Figs
Morphometric measurements in millimeters of Allobates albiventris sp. nov. and A. gasconi sensu stricto. Values represent mean ± standard deviation (range). Measurement acronyms are described in the text; n, sample size.
| Allobates albiventris sp. nov. | Allobates gasconi sensu stricto | ||||
| Characters | Holotype | Males (n = 21) | Females (n = 16) | Males (n = 24) | Females (n = 7) |
| SVL | 14.6 | 15.3±0.5 (14.3–16.4) | 16.5±0.5 (15.6–17.8) | 16.2±0.6 (14.8–17.1) | 16.8±0.8 (16.0–18.0) |
| IOD | 4.5 | 4.6±0.2 (4.3–5.0) | 4.8±0.2 (4.5–5.1) | 4.7±0.3 (4.3–5.5) | 4.7±0.2 (4.3–4.9) |
| HW | 5.1 | 5.1±0.2 (4.8–5.5) | 5.5±0.2 (5.1–5.9) | 4.9±0.3 (4.3–6.0) | 4.9±0.2 (4.5–5.1) |
| HL | 4.9 | 4.9±0.2 (4.6–5.4) | 5.3±0.2 (4.9–5.8) | 4.6±0.4 (4.0–5.7) | 4.7±0.3 (4.3–4.9) |
| IND | 2.2 | 2.2±0.1 (2.0–2.5) | 2.4±0.1 (2.3–2.6) | 2.4±0.1 (2.2–2.7) | 2.5±0.1 (2.3–2.6) |
| THL | 7.0 | 7.0±0.4 (6.4–8.0) | 7.3±0.2 (7.0–7.9) | 7.4±0.6 (6.5–8.8) | 7.4±0.3 (7.0–7.8) |
| TIL | 7.1 | 7.3±0.4 (6.7–8.1) | 7.6±0.2 (7.4–8.0) | 7.7±0.6 (6.6–9.2) | 7.7±0.4 (7.2–8.1) |
| FL | 6.9 | 6.7±0.4 (6.1–7.7) | 6.9±0.3 (6.6–7.3) | 7.4±0.5 (6.6–8.9) | 7.5±0.3 (7.0–8.1) |
| UAL | 3.6 | 3.8±0.2 (3.5–4.2) | 4.0±0.2 (3.6–4.3) | 4.0±0.2 (3.5–4.5) | 3.9±0.2 (3.8–4.4) |
| FAL | 3.3 | 3.4±0.2 (3.1–3.8) | 3.6±0.5 (3.3–5.6) | 3.6±0.3 (2.9–4.4) | 3.7±0.3 (3.5–4.3) |
| HANDI | 2.6 | 2.7±0.1 (2.5–2.9) | 2.8±0.1 (2.6–3.0) | 2.9±0.2 (2.4–3.3) | 3.0±0.2 (2.8–3.2) |
| HANDII | 2.5 | 2.6±0.1 (2.4–2.8) | 2.7±0.1 (2.5–2.9) | 2.7±0.2 (2.4–3.1) | 2.8±0.1 (2.6–3.0) |
| HANDIII | 3.5 | 3.6±0.2 (3.2–4.0) | 3.8±0.1 (3.5–4.1) | 3.9±0.3 (3.4–4.4) | 4.0±0.2 (3.8–4.2) |
| HANDIV | 2.3 | 2.4±0.2 (2.1–2.7) | 2.5±0.1 (2.4–2.7) | 2.6±0.3 (2.0–3.1) | 2.7±0.1 (2.5–2.8) |
| WFD | 0.5 | 0.5±0.1 (0.4–0.6) | 0.6±0.0 (0.5–0.7) | 0.5±0.1 (0.4–0.6) | 0.5±0.0 (0.5–0.6) |
| WPF | 0.3 | 0.3±0.0 (0.2–0.4) | 0.3±0.0 (0.3–0.4) | 0.4±0.1 (0.3–0.5) | 0.3±0.0 (0.3–0.4) |
| DPT | 0.5 | 0.5±0.1 (0.5–0.6) | 0.6±0.0 (0.5–0.7) | 0.6±0.1 (0.4–0.8) | 0.5±0.0 (0.5–0.6) |
| WTT | 0.4 | 0.4±0.0 (0.3–0.4) | 0.4±0.0 (0.3–0.5) | 0.5±0.1 (0.3–0.7) | 0.5±0.1 (0.3–0.7) |
| WTD | 0.6 | 0.7±0.1 (0.5–0.8) | 0.7±0.1 (0.6–0.8) | 0.6±0.1 (0.5–0.7) | 0.7±0.1 (0.6–0.8) |
| TYM | 0.8 | 0.9±0.1 (0.7–1.1) | 0.9±0.1 (0.9–1.1) | 0.8±0.1 (0.6–0.9) | 0.9±0.1 (0.6–0.9) |
| EL | 2.0 | 2.1±0.1 (2.0–2.4) | 2.2±0.1 (2.1–2.4) | 2.1±0.1 (1.9–2.4) | 2.3±0.1 (2.1–2.5) |
| END | 1.5 | 1.4±0.1 (1.2–1.8) | 1.5±0.1 (1.4–1.7) | 1.9±0.2 (1.4–2.1) | 1.9±0.1 (1.8–2.0) |
| SL | 2.2 | 2.0±0.2 (1.7–2.4) | 2.1±0.1 (1.9–2.4) | 2.5±0.2 (2.1–2.9) | 2.7±0.1 (2.5–2.8) |
Palmar tubercle rounded and conspicuous, diameter 0.42 mm. Thenar tubercle elliptical and conspicuous, width 0.29 mm. Diameter of thenar tubercle equals 69% of that of the palmar tubercle. Subarticular tubercles protruding, oval on finger I and rounded in other fingers; two tubercles on finger III but one in each of the others; distal tubercle smaller than proximal tubercle on finger III; tubercle on finger I larger than others. Supernumerary tubercles absent. Lateral keels on fingers I–IV, poorly defined on finger I. When placed side by side, the tip of finger IV reaches the distal subarticular tubercle of finger III. Preaxial phalangeal swelling on finger II and III. Relative length of fingers: IV < II < I < III. Discs are wider than the third phalanx on fingers I, III and IV, but approximately the same width on finger II. Paired dorsal digital scutes present.
Tibia and thigh lengths approximately the same (TIL/THL = 1.01), equal 49% and 48% of SVL, respectively. Foot length 97% of tibia length. Tarsal keel conspicuous and curved, narrowing towards the internal metatarsal tubercle. Internal metatarsal tubercle protuberant, elliptical. External metatarsal tubercle small and round, protruding, smaller than diameter of internal metatarsal tubercle. Metatarsal fold absent. Lateral keels present on preaxial and postaxial sides of each toe. Basal webbing between toes II and IV. Subarticular tubercles rounded and evident; one each on toes I and II but two each on toes III–V. Discs rounded, wider than distal phalanx on toes II, III and IV but of similar width on toe I; disc of toe V with smaller expansion compared to toes II–IV. Paired dorsal digital scutes present.
Dorsal skin smooth with small flattened and barely visible tubercles, mostly on the posterior portion; skin on arms smooth; skin on legs smooth with small tubercles. Ventral surface of body, arms and legs smooth.
In preservative (Fig.
Coloration in life is similar to that in preservative. Dark marks, spots, stripes, lines and bars are more conspicuous. Background coloration of the dorsum cream. Ventrolateral stripe discontinuous from the posterior corner of the eye to the axilla; small iridescent dots and spots visible below the dark brown band (Fig.
Variation in morphometric measurements of Allobates albiventris sp. nov. is summarized in Table
Unlike the holotype, a third subarticular tubercle is present on the proximal portion of toe IV in 53% of the rest of the type series (12 males and 8 females). When present, it is approximately half the size of other subarticular tubercles on the same toe (Fig.
Paratypes of Allobates albiventris sp. nov. A Female, MPEG44612, SVL 16.2 mm. B Male, INPAH45038, SVL 14.7 mm. C, F Female, INPAH45054, SVL 17.0 mm. D Male, INPAH45060, SVL 15.6 mm. E Male, INPAH45046, SVL 14.9 mm. G, H Male, INPAH45064, SVL 16.4 mm. White rectangle in (G) delimits the magnified region (H) illustrating the third tubercle on toe IV (arrow). Photographs by J.R.D. Souza.
In preservative, dorsal coloration of the type series ranges from light to dark brown (Fig.
As in the holotype, coloration in life is similar to that in preservative (Fig.
Coloration in life of Allobates albiventris sp. nov. from Manoel Urbano and Rio Branco, State of Acre, Brazil. A–C Male holotype, SVL 14.6 mm; D–F Female, INPAH45051, SVL 16.8 mm; G–I Male,
The advertisement call of Allobates albiventris sp. nov. is formed by a pair of notes that is emitted singly or in a series of as many as 16 calls. Calls emitted in series of one, two, three, four or five calls correspond to 88% of recorded call arrangements (Fig.
Advertisement calls of the holotype of Allobates albiventris sp. nov. (INPAH45035, FNJV 53687). A Oscillogram showing the continuous emission of calls with variable arrangements. Spectrograms and oscillograms of the four most common call arrangements: single call (B) and series of two (C), three (D) and four calls (D). Note that each call is composed of two notes. Air temperature: 22°C. Abbreviations: dB, decibels; kHz, kilohertz; s, seconds.
Advertisement call parameters of Allobates albiventris sp. nov. Values represent the mean for each calling male. Call parameters are described in the text. Localities: ANT, Antimary River; FEI, Feijó; MUR, Manoel Urbano; PCM, Parque Ambiental Chico Mendes; REA, Reserva Extrativista Arapixi. Abbreviations: AT, air temperature in degrees Celsius; FNJV, call voucher recordings are deposited in the Fonoteca Neotropical Jacques Vielliard; SD, standard deviation.
| FNJV | Locality | AT | CSD | ICSI | CD | ICI | ND1 | INI | ND2 | LFN1 | HFN1 | DFN1 | LFN2 | HFN2 | DFN2 |
| Unvouchered | FEI | NA | 480 | 2,010 | 49 | 160 | 12 | 19 | 18 | 5,015 | 5,608 | 5,336 | 5,361 | 5,831 | 5,607 |
| Unvouchered | PCM | NA | 1,040 | 1,190 | 58 | 240 | 13 | 20 | 24 | 4,893 | 5,523 | 5,222 | 5,263 | 5,739 | 5,487 |
| 53688 | PCM | 23.0 | 1,560 | 1,210 | 52 | 210 | 11 | 21 | 20 | 5,448 | 6,048 | 5,792 | 5,875 | 6,336 | 6,141 |
| 53689 | PCM | 23.5 | 700 | 1,680 | 52 | 230 | 10 | 22 | 20 | 4,823 | 5,362 | 5,065 | 5,118 | 5,617 | 5,381 |
| Unvouchered | REA | 28.0 | 940 | 1,230 | 49 | 280 | 10 | 20 | 18 | 5,374 | 6,008 | 5,705 | 5,695 | 6,222 | 5,991 |
| 53692 | REA | 28.0 | 440 | 620 | 47 | 200 | 11 | 17 | 20 | 5,181 | 5,944 | 5,606 | 5,685 | 6,273 | 6,002 |
| 53693 | REA | 29.0 | 360 | 760 | 48 | 210 | 13 | 16 | 18 | 5,023 | 5,714 | 5,400 | 5,522 | 6,006 | 5,768 |
| 53680 | ANT | 25.0 | 790 | 920 | 48 | 210 | 12 | 16 | 20 | 4,739 | 5,213 | 5,017 | 5,276 | 5,658 | 5,476 |
| 53681 | ANT | 24.5 | 1,050 | 690 | 51 | 240 | 13 | 16 | 21 | 5,09 | 5,673 | 5,416 | 5,548 | 6,083 | 5,861 |
| 53682 | MUR | 24.0 | 670 | 640 | 49 | 230 | 15 | 14 | 19 | 5,194 | 5,621 | 5,405 | 5,619 | 6,070 | 5,840 |
| 53685 | MUR | 22.0 | 1,400 | 2,120 | 48 | 220 | 13 | 14 | 20 | 5,312 | 5,858 | 5,618 | 5,702 | 6,307 | 6,083 |
| 53686 | MUR | 22.0 | 650 | 730 | 45 | 200 | 13 | 11 | 21 | 5,352 | 5,941 | 5,591 | 5,995 | 6,507 | 6,294 |
| 53687 | MUR | 22.0 | 780 | 660 | 45 | 230 | 13 | 12 | 20 | 5,098 | 5,663 | 5,392 | 5,709 | 6,267 | 6,036 |
| 53684 | MUR | 22.0 | 630 | 880 | 47 | 200 | 16 | 11 | 20 | 5,179 | 5,73 | 5,465 | 5,702 | 6,176 | 5,978 |
| 53683 | MUR | 22.0 | 610 | 850 | 51 | 230 | 16 | 15 | 21 | 5,044 | 5,523 | 5,237 | 5,519 | 6,033 | 5,810 |
| 53691 | MUR | 22.0 | 440 | 560 | 45 | 160 | 13 | 12 | 21 | 5,084 | 5,638 | 5,353 | 5,568 | 6,082 | 5,825 |
| 53690 | MUR | 21.0 | 550 | 950 | 50 | 240 | 12 | 17 | 20 | 5,036 | 5,493 | 5,278 | 5,568 | 6,020 | 5,805 |
| Mean | – | 23.9 | 700 | 1,010 | 50 | 210 | 13 | 16 | 20 | 5,120 | 5,687 | 5,409 | 5,577 | 6,076 | 5,849 |
| SD | – | 2.6 | 650 | 670 | 4 | 50 | 2 | 4 | 2 | 206 | 228 | 211 | 233 | 247 | 250 |
| Min | – | 21.0 | 40 | 410 | 42 | 130 | 8 | 8 | 14 | 4,640 | 5,153 | 4,953 | 4,909 | 5,413 | 5,189 |
| Max | – | 29.0 | 4,470 | 4,400 | 60 | 390 | 20 | 23 | 26 | 5,576 | 6,127 | 5,857 | 6,195 | 6,552 | 6,331 |
Descriptions of quantitative characters of tadpoles are based on six specimens at Gosner stage 34. Morphometric measurements are presented in Table
Morphometric measurements in millimeters of 12 tadpoles of Allobates albiventris sp. nov., Gosner stages 34–37, from Manoel Urbano, Acre, Brazil. Values depict mean ± standard deviation (range). Trait acronyms are defined in the text; n, sample size.
| Traits | Stage 34 (n = 6) | Stage 35 (n = 1) | Stage 36 (n = 3) | Stage 37 (n = 2) |
| TL | 17.14 ± 0.48 (16.55–17.81) | 17.72 | 19.26 ± 0.13 (19.15–19.40) | 20.03 ± 0.06 (19.99–20.08) |
| TAL | 11.61 ± 0.38 (11.26–12.26) | 12.10 | 13.13 ± 0.05 (13.10–13.19) | 13.69 ± 0.00 (13.69–13.69) |
| BL | 5.53 ± 0.19 (5.29–5.80) | 5.63 | 6.13 ± 0.08 (6.05–6.22) | 6.34 ± 0.06 (6.30–6.38) |
| BW | 3.85 ± 0.36 (3.36–4.28) | 4.12 | 3.53 ± 0.08 (3.44–3.61) | 4.03 ± 0.24 (3.86–4.20) |
| BH | 2.23 ± 0.19 (1.93–2.44) | 2.18 | 2.27 ± 0.15 (2.10–2.35) | 2.60 ± 0.12 (2.52–2.69) |
| HWLE | 3.19 ± 0.21 (3.02–3.53) | 3.70 | 3.02 ± 0.00 (3.02–3.02) | 3.40 ± 0.06 (3.36–3.44) |
| TMW | 1.55 ± 0.09 (1.43–1.68) | 1.43 | 1.51 ± 0.08 (1.43–1.60) | 1.64 ± 0.18 (1.51–1.76) |
| MTH | 2.58 ± 0.09 (2.44–2.69) | 2.69 | 2.80 ± 0.10 (2.69–2.86) | 2.94 ± 0.12 (2.86–3.02) |
| TMH | 1.54 ± 0.10 (1.43–1.68) | 1.51 | 1.62 ± 0.05 (1.60–1.68) | 1.68 ± 0.00 (1.68–1.68) |
| IOD | 0.99 ± 0.35 (0.92–1.05) | 1.01 | 1.04 ± 0.05 (1.02–1.09) | 1.13 ± 0.06 (1.09–1.18) |
| IND | 1.33 ± 0.06 (1.26–1.43) | 1.43 | 1.48 ± 0.13 (1.34–1.60) | 1.47 ± 0.06 (1.43–1.51) |
| END | 0.57 ± 0.04 (0.50–0.63) | 0.55 | 0.52 ± 0.02 (0.50–0.55) | 0.59 ± 0.00 (0.59–0.59) |
| NSD | 0.52 ± 0.07 (0.42–0.63) | 0.50 | 0.67 ± 0.15 (0.50–0.80) | 0.57 ± 0.09 (0.50–0.63) |
| ED | 0.82 ± 0.04 (0.76–0.88) | 0.84 | 0.91 ± 0.06 (0.84–0.97) | 0.92 ± 0.00 (0.92–0.92) |
| SS | 3.77 ± 0.23 (3.36–4.03) | 4.20 | 4.17 ± 0.27 (3.86–4.37) | 4.09 ± 0.06 (4.03–4.12) |
| VTL | 1.39 ± 0.13 (1.23–1.60) | 1.55 | 1.50 ± 0.19 (1.36–1.71) | 1.50 ± 0.05 (1.46–1.53) |
| STL | 0.55 ± 0.07 (0.46–0.67) | 0.42 | 0.55 ± 0.04 (0.50–0.59) | 0.67 ± 0.06 (0.63–0.71) |
| ODW | 1.67 ± 0.18 (1.44–1.93) | 1.53 | 1.46 ± 0.14 (1.33–1.61) | 1.76 ± 0.23 (1.60–1.92) |
| PL | 0.68 ± 0.06 (0.59–0.74) | 0.81 | 0.67 ± 0.13 (0.52–0.76) | 0.85 ± 0.06 (0.81–0.89) |
| AL | 0.48 ± 0.03 (0.42–0.50) | 0.50 | 0.62 ± 0.03 (0.59–0.64) | 0.59 ± 0.07 (0.54–0.64) |
| DG | 0.47 ± 0.05 (0.40–0.54) | 0.62 | 0.55 ± 0.04 (0.50–0.59) | 0.57 ± 0.05 (0.54–0.60) |
| A1 | 1.16 ± 0.05 (1.08–1.21) | 1.14 | 1.13 ± 0.07 (1.08–1.21) | 1.23 ± 0.06 (1.19–1.28) |
| A2 | 1.07 ± 0.04 (1.01–1.11) | 1.02 | 1.05 ± 0.04 (1.01–1.09) | 1.18 ± 0.01 (1.18–1.19) |
| P1 | 1.02 ± 0.11 (0.82–1.11) | 0.99 | 1.01 ± 0.10 (0.91–1.11) | 1.19 ± 0.00 (1.19–1.19) |
| P2 | 0.98 ± 0.08 (0.82–1.08) | 0.97 | 0.99 ± 0.04 (0.94–1.02) | 1.18 ± 0.00 (1.18–1.18) |
| P3 | 0.67 ± 0.14 (0.50–0.84) | 0.49 | 0.49 ± 0.04 (0.47–0.54) | 0.76 ± 0.04 (0.74–0.79) |
| UJW | 0.67 ± 0.00 (0.67–0.67) | 0.67 | 0.56 ± 0.10 (0.50–0.67) | 0.67 ± 0.00 (0.67–0.67) |
| UJL | 0.74 ± 0.05 (0.67–0.82) | 0.94 | 0.81 ± 0.04 (0.76–0.84) | 0.77 ± 0.07 (0.77–0.77) |
Oral disc positioned anteroventrally, laterally emarginate, oval in ventral view (Fig.
In preservative, body and tail muscles assume different shades of cream, with brown melanophores forming blotches and spots of various shapes and sizes. Fins cream but translucent, with brown spots of various shapes and sizes resembling a marbled pattern. Venter cream but translucent, with thickened brown melanophores mainly in the central region. Internal organs are visible through the skin (Fig.
Allobates albiventris sp. nov. is known from only five localities in southwestern Brazilian Amazonia: four in the State of Acre and one in the State of Amazonas (Figs
Geographic distribution of Allobates albiventris sp. nov. Star = type locality (1 Manoel Urbano); circles = additional paratype localities (2 Antimary River; 3 Parque Ambiental Chico Mendes); and rhombus (4 Feijó; 5 Reserva Extrativista Arapixi). White triangles denote sampled localities where the new species was not recorded.
Allobates albiventris sp. nov. breeds in the rainy season between November and March. Males vocalize both on litterfall and while perched on shrubs or fallen branches up to 40 cm above ground (Fig.
Habitat and natural history of Allobates albiventris sp. nov. A Typical understory of open ombrophilous forest at the type locality in Manoel Urbano, State of Acre, Brazil. B Beginning of courtship behavior, in which a male is leading a female to an oviposition site. C Female (unvouchered) positioning herself to jump to the adaxial surface of the leaf, where the male is vocalizing. D Mating pair (unvouchered) in cephalic amplexus. E Mating pair (unvouchered) on the leaf, with the female in oviposition and the male silent. F Recently deposited clutch, with the smallest clutch recorded (17 eggs). G The largest clutch recorded (31 eggs). H Mating pair on a leaf, where a male vocalizes while a female deposits a second clutch on the same leaf. I Male INPAH45045 carrying 10 tadpoles on his back. Photographs by J.R.D. Souza.
Four mating pairs were observed in courtship, one at the type locality and three in Parque Ambiental Chico Mendes. Each observation began with the approach of a female to the perch where a male was emitting courtship calls. In each case, the male, perceiving the approach of a female, began to emit courtship calls interspersed with advertisement calls. He then jumped from the call perch and attempted to guide the female (Fig.
During oviposition, females repeatedly moved their heads upwards. This movement was interspersed with continuous clockwise or counterclockwise rotations relative to the vertical plane. Oviposition lasted ~11 to 15 min and ended when the female stopped the tilting motion with her head. However, she remained at the nest, on the clutch, and performed sporadic returns (apparently, hydrating the clutch, as her skin became excessively moist). Residence time of each female after oviposition ranged from 10 to 15 min, and the total time in the nest from 21 to 30 min. Males returned to the nest between 25 and 30 min after the female left, probably to hydrate the eggs and promote swelling of the surrounding jelly. We collected one clutch immediately after the female’s departure, prior to the male’s return, and the embryos developed normally. Only one male was observed performing larval transport (Fig.
Nearly 10 years ago,
Allobates albiventris is known from five lowland localities in southwestern Brazilian Amazonia. The species inhabits open ombrophilous forests dominated by bamboos of the genus Guadua and occupies pristine as well as secondary forests with low to moderate levels of anthropization (e.g., Parque Ambiental Chico Mendes and Reserva Extrativista Arapixi). Twelve additional localities, all at elevations above 300 m asl, were sampled in the upper Juruá and Purus river basins, but A. albiventris was only found below 200 m asl. We also surveyed seven permanent sampling modules along the upper Madeira River, all < 200 m asl in open ombrophilous forests dominated by palms, but we found only A. aff. albiventris (gasconi) SL3 (
This work was funded by the Brazilian Conselho Nacional de Desenvolvimento Científico e Tecnológico—CNPq (Universal grant no. 401120/2016-3 to APL), Brazilian Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) and Fundação de Amparo a Pesquisa do Estado do Amazonas—FAPEAM (BIODIVERSA Edital 007/2021, proc. 001760.2021-00). Miquéias Ferrão received an Edward O. Wilson Biodiversity Postdoctoral Fellowship from the Harvard Museum of Comparative Zoology and a fellowship from the David Rockefeller Center for Latin American Studies of Harvard University. Antonio Saulo Cunha Machado received a fellowship from FAPEAM (BIODIVERSA proc. 01.02.016301.03252/2021-67). Fieldwork in the Arapixi Extractive Reserve was supported by the Programa de Áreas Protegidas da Amazônia (ARPA), grant 010483/15. Paulo Roberto Melo-Sampaio received a fellowship from the Coordenacão de Aperfeiçoamento de Pessoal de Nível Superior (CAPES; process 88882.183267/2018-01). Funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
The authors declare that they have no competing interests.
We thank Ana Prudente (
Species, museum voucher specimens and GenBank accession numbers of sequences used in molecular analyses. Accession numbers in bold font denote sequences generated in the present study.
| Species | Voucher | 12S | 16S | ND1 | COI | cyt b |
|---|---|---|---|---|---|---|
| Allobates aff. granti | 125PG | JN690205 | JN690931 | |||
| A. aff. magnussoni | 977126 | MT627173 | MT627173 | MT627173 | MT627173 | MT627173 |
| A. aff. melanolaemus | MTR28013 | MT627203 | MT627203 | MT627203 | MT627203 | MT627203 |
| A. aff. olfersioides 1 | MTR17821 | KDQF01003353 | ||||
| A. aff. olfersioides 2 | MTR16435 | MT627202 | MT627202 | MT627202 | MT627202 | MT627202 |
| A. aff. olfersioides 3 | JFT959 | KDQF01002701 | ||||
| A. aff. tapajos 1 | MTR10084 | MT627197 | MT627197 | MT627197 | MT627197 | MT627197 |
| A. aff. tapajos 2 | AF1906 | MT627175 | MT627175 | MT627175 | MT627175 | MT627175 |
| A. aff. tinae 1 | MPEG13397 | DQ502213 | DQ502213 | DQ502900 | DQ502648 | |
| A. aff. trilineatus 1 | FGZC3247 | MT627185 | MT627185 | MT627185 | MT627185 | MT627185 |
| A. aff. trilineatus 2 | JMP2313 | MT627195 | MT627195 | MT627195 | MT627195 | MT627195 |
| A. aff. undulatus | AMNHA159139 | DQ283044 | DQ283044 | DQ502756 | DQ502459 | |
| A. algorei | TNHCFS5551 | HQ290950 | HQ290950 | HQ290950 | HQ290530 | |
| A. amissibilis | PK3798 | MT627204 | MT627204 | MT627204 | MT627204 | MT627204 |
| A. bacurau | INPAH35401 | KU195701 | ||||
| A. caeruleodactylus | MTR10227 | MT627199 | MT627199 | MT627199 | MT627199 | MT627199 |
| A. caldwellae | MPEG13826 | DQ502099 | DQ502099 | DQ502531 | ||
| A. carajas | BM163 | MT627183 | MT627183 | MT627183 | MT627183 | MT627183 |
| A. chalcopis | Alca1 | MT627182 | MT627182 | MT627182 | MT627182 | |
| A. albiventris sp. nov. | MCP13630 | KY886577 | KY886618 | |||
| A. albiventris sp. nov. | MNRJ91665 | KY886576 | KY886617 | |||
| A. albiventris sp. nov. | MNRJ91679 | KY886578 | KY886619 | |||
| A. albiventris sp. nov. | MNRJ91683 | KY886574 | KY886615 | |||
| A. albiventris sp. nov. | MNRJ91684 | KY886575 | KY886616 | |||
| A. albiventris sp. nov. | INPAH45061 | ON937753 | ||||
| A. albiventris sp. nov. | INPAH45060 | ON937752 | ||||
| A. albiventris sp. nov. | INPAH45064 | ON937746 | ||||
| A. albiventris sp. nov. | INPAH45065 | ON937745 | ||||
| A. albiventris sp. nov. | INPAH45048 | ON937748 | ||||
| A. albiventris sp. nov. | INPAH45044 | ON937749 | ||||
| A. albiventris sp. nov. | INPAH45035 | ON937750 | ||||
| A. albiventris sp. nov. | INPAH45051 | ON937751 | ||||
| A. albiventris sp. nov. | INPAH45040 | ON937747 | ||||
| A. conspicuus/subfolionidificans | FGZC3279 | MT627186 | MT627186 | MT627186 | MT627186 | MT627186 |
| A. crombiei | AF1097 | MT627174 | MT627174 | MT627174 | MT627174 | MT627174 |
| A. femoralis | AF3224 | MT627179 | MT627179 | MT627179 | MT627179 | MT627179 |
| A. femoralis SS | AfemShucv3a | DQ523001 | DQ523072 | DQ523142 | ||
| A. flaviventris | HJ545 | MT627192 | MT627192 | MT627192 | MT627192 | MT627192 |
| A. fratisenescus | QCAZ54377 | MF624172 | MF614174 | |||
| A. gasconi sensu stricto | GGU684 | MT524137 | ||||
| A. gasconi sensu stricto | APL23345 | ON997555 | ||||
| A. gasconi sensu stricto | APL23342 | ON997554 | ||||
| A. gasconi sensu stricto | APL23346 | ON997547 | ||||
| A. gasconi sensu stricto | APL23354 | ON997552 | ||||
| A. gasconi sensu stricto | APL23411 | ON997558 | ||||
| A. aff. albiventris SL1 | APL14410 | KJ747333 | ||||
| A. aff. albiventris SL1 | APL14411 | KJ747334 | ||||
| A. aff. albiventris SL1 | APL14416 | KJ747335 | ||||
| A. aff. albiventris SL2 | APL23940 | OQ297604 | ||||
| A. aff. albiventris SL2 | APL24058 | OQ297605 | ||||
| A. aff. albiventris SL2 | APL24068 | OQ297606 | ||||
| A. aff. albiventris SL2 | APL24070 | OQ297607 | ||||
| A. aff. albiventris SL2 | APL24071 | OQ297608 | ||||
| A. aff. albiventris SL3 | HJ480 | MT627191 | MT627191 | MT627191 | MT627191 | MT627191 |
| A. aff. albiventris SL3 | HJ299 | KDQF01002640 | ||||
| A. aff. albiventris SL5 |
|
KY886572 | ||||
| A. aff. albiventris SL5 |
|
KY886573 | KY886614 | |||
| A. aff. albiventris SL5 | OMNH36636 | DQ502209 | DQ502209 | DQ502898 | DQ502644 | |
| A. aff. albiventris SL5 | MPEG13003 | DQ502052 | DQ502052 | DQ502777 | DQ502483 | |
| A. aff. albiventris SL5 |
|
KY886570 | KY886612 | |||
| A. aff. albiventris SL5 |
|
KY886571 | KY886613 | |||
| A. goianus | SAMA8574 | MT627207 | MT627207 | MT627207 | MT627207 | MT627207 |
| A. granti | AF1998 | MT627176 | MT627176 | MT627176 | MT627176 | MT627176 |
| A. grillicantus | MPEG43046 | MW220039 | ||||
| A. grillisimilis | MTR12749 | MT627200 | MT627200 | MT627200 | MT627200 | MT627200 |
| A. hodli | ABU2194 | KX044279 | ||||
| A. humilis/pittieri | CVULA5690 | KJ940454 | KJ940454 | |||
| A. insperatus/juami | JMP1703 | MT627193 | MT627193 | MT627193 | MT627193 | MT627193 |
| A. juanii/ranoides | ARA2394 | DQ502271 | DQ502271 | DQ502933 | DQ502702 | |
| A. kamilae | HJ285 | MT627189 | MT627189 | MT627189 | MT627189 | MT627189 |
| A. kingsburyi | QCAZ16523 | AY364549 | HQ290963 | HQ290541 | ||
| A. magnussoni | BM168 | MT627184 | MT627184 | MT627184 | MT627184 | MT627184 |
| A. marchesianus | AJC2498 | MT627180 | MT627180 | MT627180 | MT627180 | MT627180 |
| A. masniger | MTR10155 | MT627198 | MT627198 | MT627198 | MT627198 | MT627198 |
| A. melanolaemus | NMP6V711404 | MT524148 | ||||
| A. nidicola | MPEG13821 | DQ502101 | DQ502101 | DQ502533 | ||
| A. niputidea | MUJ3520 | DQ502272 | DQ502272 | DQ502934 | DQ502703 | |
| A. nunciatus | MPEG36777 | MT627196 | MT627196 | MT627196 | MT627196 | MT627196 |
| A. olfersioides | MNRJ79897 | MF624178 | MF624178 | MF614175 | ||
| A. ornatus | MHNSM22863 | EU342550 | ||||
| A. pacaas | MZUSP158938 | MT076999 | ||||
| A. paleovarzensis | JMP2196 | MT627194 | MT627194 | MT627194 | MT627194 | |
| A. sieggreenae | MCP14533 | MW293942 | ||||
| A. sp. Huanuco | FGZC3348 | MT627187 | MT627187 | MT627187 | MT627187 | MT627187 |
| A. sp. Neblina | MTR15537 | MT627201 | MT627201 | MT627201 | MT627201 | MT627201 |
| A. sumtuosus | AF2212 | MT627177 | MT627177 | MT627177 | MT627177 | MT627177 |
| A. talamancae | QCAZ35236 | MT627205 | MT627205 | MT627205 | MT627205 | MT627205 |
| A. tapajos | MJH3973 | DQ502110 | DQ502110 | DQ502820 | DQ502542 | |
| A. tinae | HJ298 | MT627190 | MT627190 | MT627190 | MT627190 | MT627190 |
| A. trilineatus | AF4493 | MT524111 | ||||
| A. undulatus | AJC3040 | MT627181 | MT627181 | MT627181 | MT627181 | MT627181 |
| A. velocicantus | MCP10187/88 | MF624181 | MF624181 | MF614178 | ||
| A. zaparo | USNM546405 | DQ502026 | DQ502026 | DQ502752 | DQ502455 | |
| Ameerega hahneli | AF2673 | MT627178 | MT627178 | MT627178 | MT627178 | MT627178 |
| Anomaloglossus stepheni | MJH3928 | DQ502107 | DQ502107 | DQ502818 | DQ502539 | |
| Aromobates saltuensis/nocturnus | TNHCFS5541/AMNHA130042 | HQ290970 | HQ290970 | HQ290970 | DQ502860 | DQ502592 |
| Colostethus brachistriatus | CZPDUV4603 | MF624204 | MF624204 | MF614304 | MF614198 | |
| Dendrobates auratus | MVZHerp149723 | JX564862 | JX564862 | JX564862 | JX564862 | JX564862 |
| Epipedobates boulengeri | UMMZ227952/QCAZ16574 | HQ290997 | HQ290997 | HQ290997 | DQ502742 | DQ502447 |
| Leucostethus fugax | QCAZ16513 | HQ290958 | HQ290958 | HQ290958 | HQ290538 | |
| Mannophryne collaris | FS5523 | MT627188 | MT627188 | MT627188 | MT627188 | MT627188 |
| Phyllobates terribilis | TNHC64420/AMNHA118566 | HQ291006 | HQ291006 | HQ291006 | DQ502861 | DQ502593 |
| Rheobates palmatus | RHEOPALM | MT627206 | MT627206 | MT627206 | MT627206 | MT627206 |
| Silverstoneia nubicola/erasmios | TNHCFS4942/MAR336 | HQ290966 | HQ290966 | HQ290966 | MF614333 | MF614237 |
Specimens examined. Acronyms:
Allobates caeruleodactylus. Adults. Brazil: Amazonas: km 12 on the road to Autazes (
Allobates flaviventris. Adults. Brazil: Acre: Senador Guiomard, Fazenda Bonal (UFAC-RB 4650 [holotype], 4599–4601, 4603, 4631–35, 4675–77 [paratypes]).
Allobates fuscellus. Adults. Brazil: Amazonas: Juruá River: Penedo (
Allobates gasconi. Adults. Brazil: Amazonas: Jainu, west bank of Juruá River (
Allobates grillicantus. Adults. Brazil: Pará: Trairão (
Allobates grillisimilis. Adults. Brazil: Amazonas: Borba (
Allobates nidicola. Adults. Brazil: Amazonas: km 12 on road to Autazes (
Allobates pacaas.
Adults. Brazil: Rondônia: Parque Nacional dos Pacaás Novos (
Allobates paleovarzensis. Adults. Brazil: Amazonas: Careiro da Várzea (
Allobates subfolionidificans.
Adults. Brazil: Acre: Rio Branco, Parque Zoobotanico da Universidade Federal do Acre (
Allobates tapajos
. Adults. Brazil: Pará: Parque Nacional da Amazônia (
Allobates tinae. Adults. Brazil: Rondônia: Porto Velho, west bank of upper Madeira River (
Allobates trilineatus. Adults. Brazil: Acre: Rio Branco, Parque Zoobotânico of Universidade Federal do Acre (
Allobates vanzolinius. Adults. Brazil: Amazonas: Juruá River, Vai-Quem-Quer (
Allobates velocicantus.
Adults. Brazil: Acre: Mâncio Lima (
Table S1
Data type: .xlsx
Explanation note: Morphometric measurements of Allobates albiventris sp. nov. and A. gasconi.
Table S2
Data type: .xlsx
Explanation note: Morphometric measurements of tadpoles of Allobates albiventris sp. nov.
Figure S1
Data type: .png
Explanation note: Maximum likelihood phylogenetic tree of Allobates based on five mitochondrial genes (12S, 16S, COI, ND1 and cyt b).