Vicars in the desert: Substrate specialisation and paleo-erosion underpin cryptic speciation in an Australian arid-zone lizard lineage (Diplodactylidae: Diplodactylus)

Peter J. McDonald; Aaron L. Fenner; Janne Torkkola; Paul M. Oliver

doi:10.3897/vz.74.e128775

Abstract

Stable upland habitats in arid zone biomes are often characterised by locally endemic lineages. Explanations for this pattern include habitat or substrate specialisation (ecological specialisation) or intensifying aridity driving retreat into climatically buffered habitats (climatic refugia). Here we present an analysis of these alternative models using genetic, morphological and climate data for Diplodactylus galeatus, a gecko from central Australia that occurs in a series of isolated populations associated with dissected tablelands and mountain ranges. Analyses of mtDNA and SNP data support four distinct lineages, and dating analyses suggest divergence through the Pliocene. Morphological data show slight differences across lineages. Investigation of climate niche shows that two lineages are restricted to areas more arid than the intervening uninhabited region. These data suggest that specialisation to rocky substrates, potentially with subsequent paleo-erosion of dissected tablelands after a Pliocene wet pulse, was the key driver of divergence in this clade. Based on their deep genetic divergence, and differences in morphology and pattern, we recognise two isolated populations as new species.

Keywords

Aridfication, Diplodactylus fyfei sp. nov, Diplodactylus galeatus, Diplodactylus tjoritjarinya sp. nov., paleo-erosion, stony deserts, vicariance

Introduction

Mountain ranges in arid biomes are often characterised by endemic taxa (Gibson et al. 2012; Gonçalves et al. 2012; Pepper et al. 2013a; Garcia-Porta et al. 2017; Ashman et al. 2018). One potential explanation for localised endemism in arid mountain ranges is that they have provided isolated and climatically buffered refugia from intensifying aridity (Gibson et al. 2012; McDonald et al. 2021). An alternative, or potentially complementary, explanation for such localised endemism is that rocky substrates and microhabitats enable persistence of associated specialist taxa through periods of major habitat change, such as the expansion and movement of unstable sand dune habitats in surrounding areas (Byrne et al. 2008; Oliver et al. 2019). Understanding the relative roles of these processes has potentially important implications for conservation, as climatic relics may be predicted to be more vulnerable to future climatic changes than ecologically specialist taxa well adapted to climatic extremes (McDonald et al. 2021).

The vast Australian arid zone (AAZ) is characterised by several upland areas showing high levels of localised endemism, especially the Pilbara region in the west and Central Uplands in the centre (Crisp et al. 2001; Byrne et al. 2008; Pepper et al. 2013b; Oliver and McDonald 2016; Ashman et al. 2018). The AAZ has had a dynamic climatic and environmental history over the last 15 million years (Byrne et al. 2008). Paleoclimatic data indicate that there have been periods of marked intensification, amelioration and yet further intensification of arid conditions (Sniderman et al. 2016). Geological data indicate that the extent of many contemporary landforms such as sandy and stony desert has also changed greatly (Fujioka et al. 2005, 2009). In the face of this dynamic history, upland areas have been relatively stable and provided opportunities for localised persistence.

Endemism associated with arid uplands is particularly apparent in Australia’s gekkotan lizards (Fujita et al. 2010; Pepper et al. 2011b; Oliver and McDonald 2016; Ashman et al. 2018). For these taxa, mountain ranges have variably been interpreted as mesic refugia from drying conditions in the intervening lower elevation areas (Pepper et al. 2011b) or as stable landscapes that have enabled persistence of ecologically specialised rock-associated lineages (Oliver et al. 2019). Dating analyses for many gecko taxa have found that isolation predates available age estimates for the expansion of Australia’s sand deserts in the last million years (Pepper and Keogh 2021), but are coincident with major periods of aridification in the Plio-Pleistocene (Oliver and Bauer 2011; Pepper et al. 2011b; Sistrom et al. 2013; Oliver and Doughty 2016) or the late Miocene (Oliver et al. 2010; Oliver and McDonald 2016; Ashman et al. 2018). These divergence ages suggest some of these taxa are climate relicts. On the other hand, substrate specialisation with subsequent vicariance appears to have played an important role in gecko diversification in many parts of the world (Bauer et al. 2006; Heinicke et al. 2017; Oliver et al. 2019; Grismer et al. 2021).

The Diplodactylidae are a diverse family of geckos with a distribution concentrated in Australia and nearby islands (Skipwith et al. 2019). Several Australian genera in this family occur in the AAZ, either as localised populations in upland areas with geologically stable substrates (Crenadactylus, Oedura) (Oliver et al. 2010, 2014; Oliver and McDonald 2016) or across most major habitat types (Lucasium, Rhynchoedura) (Pepper et al. 2006, 2008, 2011a). The most speciose Australian genus in the family is Diplodactylus, a clade of 27 recognised species of small and largely terrestrial geckos that occur widely across arid, semiarid and tropical Australia (Wilson and Swan 2017). This genus is characterised by high levels of morphologically cryptic species diversity (Oliver et al. 2009), and the application of genetic and morphological approaches has more than doubled the number of recognised species over the last two decades (Pepper et al. 2006; Doughty et al. 2010; Doughty and Oliver 2013; Oliver et al. 2014a; Couper and Oliver 2016). These works have provided an improved framework for understanding biogeographic history. However, there remain species complexes that have not yet received detailed taxonomic treatment, including some that show evidence of localised endemism in the AAZ.

The mesa gecko or helmeted gecko (Diplodactylus galeatus Kluge, 1973) is an arid-zone species with moderate levels of intraspecific genetic divergence (Oliver et al. 2009). This species is largely terrestrial and appears to be closely associated with areas of loose surface rock, typically on mountain ranges or mesas. The species has a distribution comprising three apparently isolated populations: a southern population which includes the type locality in the dissected tablelands (Cretaceous and Lower Tertiary sediments; Fujioka et al. 2005) of the western part of South Australia’s (SA) stony deserts, a central population in a separate complex of dissected tablelands (mostly Cretaceous shale and siltstone; Wells 1969) straddling the Northern Territory (NT)/SA border, and a northern population in the rugged and geologically diverse MacDonnell Ranges of the NT. While the MacDonnell Ranges are well known as a refugia and centre of endemism (Oliver and McDonald 2016; McDonald et al. 2021), the low dissected tablelands of the stony deserts are on the periphery of Australia’s driest region (http://www.bom.gov.au/climate/maps/averages/rainfall). The central and northern populations are separated by large areas of sand desert and red earth mulga plains, while the central and southern populations are mostly separated by flat, stony gibber desert (Fig. 1).

Figure 1.

Main map (top) shows the location of museum specimens of the four taxa in the Diplodactylus galeatus species complex (‘?’ animals from near Hermannsburg assigned to D. tjoritjarinya sp. nov. southern ESU require genetic validation) in relation to IBRA regions. Background imagery courtesy of ESRI. Animals genotyped in this study are denoted with a white star symbol. Inset map shows the location of records in Australia over a 9-s digital elevation model courtesy of Geoscience Australia. Photographs show habitat for: A Diplodactylus fyfei sp. nov. in the foothills of Beddome Range on New Crown Station, Northern Territory (P. McDonald), and B Diplodactylus tjoritjarinya sp. nov. in Tjoritja National Park, Northern Territory (P. McDonald). Note the presence of small loose or partially embedded rocks in the foreground of image B – both species are frequently observed perched atop rocks at night.

Here we investigate whether isolation between populations of D. galeatus is best explained by persistence in climatic refugia or ecological specialisation with subsequent vicariance. We expand on earlier molecular work and include more samples from all populations and population-level genomic analyses, combined with morphological and climate niche comparisons. Based on the results, we propose that substrate specialisation with subsequent paleoerosion is the mechanism that best explains isolation of populations in this species group. We also present a revised taxonomy including a redescription of D. galeatus, the description of two new species and the identification of two Evolutionary Significant Units (ESUs) within one of these species.

Material and methods

Genetic sampling

Final datasets included genetic data for 44 specimens of D. galeatus, primarily composed of samples from the Australian Biological Tissues Collection (ABTC) at the South Australian Museum (SAMA) or new and more recent samples collected for this study and lodged at the Museum and Art Gallery of the Northern Territory (NTM) (Table S1). DNA was extracted using a Puregene DNA isolation kit (Gentra Systems, Minneapolis, MN, U.S.A.) following manufacturer protocols for DNA purification from solid tissue.

mtDNA data generation and analysis

Our mtDNA dataset included 17 samples of D. galeatus, comprising 11 newly sequenced samples and six sequences already available on GenBank. For new samples, a fragment of the mitochondrial genome, including the 3’ end of the NADH dehydrogenase subunit 2 (ND2) gene and the tRNA genes was amplified and sequenced using the forward primers 5’- AAGCTTTCGGGGCCCATACC -3’ and the reverse primer 5’- CTAAAATRTTRCGGGATCGAGGCC -3’. The mtDNA alignment comprised of 837 bp from the ND2 gene. These were aligned using the MUSCLE algorithm (Edgar 2004) and subsequently checked by eye for missense mutations and correct reading frames. Pairwise sequence divergences (uncorrected p distances) were calculated in MEGA 6.06 (Kumar et al. 2018). Lineage relationships within the D. galeatus complex were visualised by generating phylogenetic networks of mtDNA using the Neighbor-Net algorithm as implemented in SplitsTree v4.10 (Huson and Bryant 2006). Apomorphic diagnostic single nucleotide polymorphisms were visually identified from the ND2 alignment across members of the D. galeatus complex following methods outlined elsewhere (Renner 2016; Donnellan et al. 2023). SNP sites were numbered in reference to the first base pair of ND2 on an annotated GenBank accession of D. galeatus (AY369009). Polarity of apomorphic states was estimated relative to an exemplar of the closest lineage to the D. galeatus complex (D. tessellatus AMS R143855, JQ173631).

To infer the timing and pattern of divergences in the D. galeatus complex in a broader context we used BEAST v.2.6 (Bouckaert et al. 2014). This program assumes each tip represents an evolutionarily independent population, so we reduced sampling to exemplars of the most genetically distinctive populations of Diplodactylus, including four main lineages in the D. galeatus complex. Third codon sites were removed from BEAST analyses to reduce the potential for saturation to confound branch length estimation. Topology and timeframes of divergence were estimated using the relaxed-clock model and Yule speciation prior for 50 million generations, sampling every 10,000 generations, with the first 20% of trees discarded as burn-in. Data were partitioned by codon and the HKY+G model was applied to each partition. There are no fossil calibrations for the age of any Australian diplodactyloid geckos, so we used two normal secondary age priors taken from Brennan and Oliver (2017), specifically: a) the age of the note subtending D. galeatus and the 2n = 28 and 2 n = 30 races of D. tessellatus (mean 12 mya, sigma 2), and b) a broad normal prior on the crown age of Diplodactylus (mean 20 mya, sigma 4).

SNP data generation and analysis

Given the overall morphological similarity between the main mtDNA lineages identified (see results), we undertook additional genetic analyses of population differentiation and relationships using SNP data generated by Diversity Array Technology (DArT). This method uses restriction-enzyme mediated genome reduction (Jaccoud 2001) prior to library construction and Next-Generation-Sequencing to sequence the most informative representations of genomic DNA sampling. The method is an alternative to whole genome sequencing, and has proven valuable for testing hypotheses of evolutionary independence and comparing genetic diversity across populations (Melville et al. 2016; Unmack et al. 2017; Gruber et al. 2018). We sampled 43 D. galeatus, as much as possible including exemplars from across the geographic range of each major mtDNA lineage. SNPs were called on data from the D. galeatus complex alone.

We used the R package ‘dartR’ (Gruber et al. 2018) to apply additional filtering to the SNP data in R version 4.1.2 (R Core Team 2022). To ensure the data quality, we removed secondary SNPs where they were restricted to a single sequenced tag using the gl.filter.secondaries() function, filtered loci by call rate (98%) using the gl.filter.callrate() function, and removed any monomorphic loci using the gl.filter.monomorphs() function. To visualise the divergence between samples and identify any potential hybrids we generated a distance-based principal coordinates analysis (PCoA) using the genetic distance matrix with the gl.pcoa() function in dartR (Gruber et al. 2018). We assessed divergence between population clusters in the PCoA based on the proportion of loci with fixed allelic differences. Fixed differences occur when two populations share no alleles at a single site. We tested for absolute fixed differences with simulation (1000 replications) using the gl.fixed.differences() function in dartR. We estimated phylogenetic relationships based on the 180 filtered SNP data in IQ-TREE version 1.6.12 (Nguyen et al. 2015) using the GTR+G model and fast bootstrapping (– bb 1000).

We conducted clustering analyses in dartR using STRUCTURE v2.3.4, which uses Bayesian Inference to determine the number of distinct genetic clusters (K) in the SNP dataset. Analyses used a range of cluster values (K = 1–5), both with and without admixture among populations. We also ran clustering analyses in ADMIXTURE v1.3 (Alexander et al. 2009) that, like STRUCTURE, uses SNP data to analyses population structure, except using a Maximum Likelihood function. ADMIXTURE v1.3 is available as a binary execution file for Linux or Mac, so we used Oracle VirtualMachine to run the binary via an Ubuntu command line. To evaluate which number of clusters is most representative of our dataset, we selected K with the highest log-likelihood in STRUCTURE, and K with the lowest Cross Validation Error in ADMIXTURE.

Morphology

To understand patterns of morphological variation across populations we examined all Diplodactylus galeatus specimens held at SAMA (the type specimen was examined based on photographs) and NTM. The following characters were measured in mm (to one decimal place) using vernier callipers for all specimens except likely juveniles (<40 mm SVL): SVL – snout-vent length; TrunkL – Trunk length, between axilla and groin; TailL – tail length, from cloaca to tip (only original tails were used in analyses); TailW – tail width, at widest point; HeadL – head length, measured obliquely from tip of snout to angle of lower jaw; HeadW – head width, at widest point; HeadD – head depth, measured behind eyes and top of head; ArmL – arm length, from elbow to base of hand; LegL – knee to base of foot; IO – inter-orbital distance; OrbL – lower anterior to upper posterior of eye socket; NarEye – nare-eye distance, nostril to anterior corner of eye socket; SnEye – tip of snout to lower anterior corner of eye socket; IntNar – internarial distance between nostrils; Ros – rostral scale height; RosCre – proportion of rostral crease relative to rostral scale height; MenL – mental scale length, from mouth to posterior edge; MenW – mental scale width, at anterior edge; and Ear – width of external ear opening. We present mean and standard deviations and the range of values for each population.

We undertook body size corrections for each measurement to account for allometric growth using the allom() function in the R package ‘GroupStruct’ (Thorpe 1975; Chan and Grismer 2022). To test for differences in morphology between the three populations we ran univariate analysis of variance (ANOVA) and Tukey’s post-hoc tests for SVL and each allometry-corrected measurement. To further examine potential divergence in morphology across the populations we ran a PCA using the built-in R function prcomp() across 11 of the allometry-corrected morphometric measures (TrunkL, HeadL, HeadW, HeadD, ArmL, LegL, OrbL, SnEye, IntNar, Rostral and Ear).

Climate niche space

To assess whether populations in the D. galeatus complex are associated with relatively less arid areas (i.e., putative refugia), we plotted climate values at species occurrence locations using annual precipitation (mm) and annual potential evapotranspiration (mm) grids from Australian Bureau of Meteorology (http://www.bom.gov.au/climate/maps/average). These climate variables form the basis of the global precipitation/evapotranspiration bioclimatic ratio for measuring aridity (Whitford and Duval 2020). Resolution of rainfall data was 0.05 degrees (approximately 5 km grain size) and evapotranspiration was 0.1 degrees (approximately 10 km grain size). We also extracted these values at 1000 points randomly selected across the two IBRA (Interim Biogeographic Regionalisation’s of Australia) regions inhabited by the D. galeatus species complex (Stony Plains and MacDonnell Ranges) as well as the intervening Finke IBRA region. All spatial data handling was completed in ArcMap 10.6.1 (ESRI) and plotting undertaken in R (R Core Team 2022).

Species concepts

As outlined elsewhere (Oliver et al. 2020) we consider populations to be species when they show evidence from multiple independent data sources for a history of evolutionary independence (i.e., the Generalised Lineage Concept sensu de Queiroz 2007). Under this framework we recognise as species lineages that satisfy two or more of the following criteria: (i) statistically-supported reciprocal monophyly in nDNA phylograms; (ii) evidence from SNPs for discrete population structure and lack of geneflow; or (iii) diagnostic morphological characters based on post-hoc analyses of groups that satisfy (i) or (ii). We consider that sustained lack of gene flow, supported by multiple lines of evidence and comprehensive sampling of geographic space and genes, is sufficient to delimit species.

Results

We hereafter refer to populations within the D. galeatus complex by the names they are assigned in this paper. Accordingly, we consider D. galeatus restricted to South Australia, the population on the border of South Australia and the Northern Territory as D. fyfei sp. nov., and the population from the MacDonnell Ranges to D. tjoritjarinya sp. nov. (Fig. 1).

mtDNA diversity and dating

Phylogenetic analyses of the mtDNA data highlight four main divergent lineages within the D. galeatus complex (Fig. 2A), with p distances among these ranging from 0.83–0.114 (Tables 1, S2). Multiple samples spanning the distributions of three of these four lineages were included in analyses, and in all cases lineages were monophyletic and showed much lower within-lineage divergences (max within lineage p distance was 0.045). One lineage corresponds to D. galeatus and occurs in a broad area of northern South Australia. A second lineage occurs in isolated breakaways and ranges on the border between South Australia and the Northern Territory, and corresponds to D. fyfei sp. nov. The final two lineages, occurring in the northern and southern MacDonnell Ranges, show the lowest levels of mtDNA divergence observed between major lineages (0.082–0.084), and correspond to the northern and southern ESUs of D. tjoritjarinya sp. nov., respectively. In the ND2 alignment (Table 2), 16 diagnostic (apomorphic) sites distinguish D. galeatus, seven diagnostic sites distinguish D. fyfei sp. nov. and 22 distinguish D. tjoritjarinya sp. nov.

Figure 2.

Results of analyses of mtDNA data for the ND2 gene. A Splitstree network showing p distances between samples and support for major groupings based in 1000 bootstrap replicates, and B chronogram for the genus Diplodactylus estimated in BEAST using 1^st and 2^nd codon positions and a secondary node-age constraints.

Table 1.

Download as

CSV

XLSX

Genetic divergences (p distances) within and between the major lineages in the D. galeatus complex based on an 837 base pair alignment of the ND2 gene. Values in bold indicate ranges of intra-lineage divergences, while other value indicate average divergences between lineages.

	1	2	3	4
1. D. galeatus	0.000–0.045
2. D. fyfei sp. nov	0.111	0.001–0.009
3. D. tjoritjarinya sp. nov. north	0.102	0.114	0.009-0.013
4. D. tjoritjarinya sp. nov. (south)	0.100	0.102	0.083	na

Table 2.

Download as

CSV

XLSX

Apomorphic diagnostic polymorphism sites in the ND2 alignment of the Diplodactylus galeatus complex. Bold indicates apomorphic sites compared to the rest of the galeatus group.

site #	3	3	4	5	8	1	1	2	2	2	2	2	2	2	3	3	3	3	3	3	3	3	4	4
	1	4	4	7	1	0	2	1	1	2	3	5	7	7	0	3	4	5	5	7	8	9	3	4
Species						7	7	6	7	8	1	8	1	9	0	1	8	1	7	3	7	3	2	5
tessellatus	C	A	T	T	A	G	A	C	T	C	C	C	A	A	A	T	A	A	C	C	C	A	T	T
galeatus	T	A	C	C	A	G	C	T	T	T	T	C	A	G	C	A	A/T	A	A	C	T	A	C	C
fyfei	C	A	T	T	A	G	A	C	T	T	C	T	G	A	C	A	A	A	C	C	C	G	T	T
tjoritjarinya	C	T	T	T	C	A	A	C	G	G	C	C	A	A	T	G	G	G	C	T	C	A	T	T

site #	4	4	4	4	5	5	6	6	6	6	6	6	6	6	7	7	7	7	7	7	7	Total Apomorphic sites
	7	7	9	9	0	8	0	1	3	3	4	5	9	9	0	1	2	3	5	9	9
Species	1	7	5	8	4	2	0	5	0	9	8	2	0	6	3	4	6	8	6	5	8
tessellatus	A	T	G	A	T	C	T	T	A	A	C	A	A	T	C	T	A	A	C	T	T
galeatus	A	T	G	C	T	A	C	T	A	A	C	A	T	T	T	C	A	A	C	T	C	16
fyfei	A	T	G/T	G	T	C	T	T	A	A	C	A	T	C	T	T	A	T	C	C	T	7
tjoritjarinya	G	C	A	C	C	C	T	C	T	T	T	T	C	T	T	T	C	A	A	T	T	22

In phylogenetic analyses of the species-level alignment of ND2 data (Fig. 2B) the monophyly of the D. galeatus complex was strongly supported, while the pattern of relationships among the four main lineages of D. galeatus complex were poorly resolved – with the exception of the sister clade pairing of the north and south lineages of D. tjoritjarinya sp. nov. The four main lineages were inferred to have diverged from each other over a relatively short timeframe centred on the Pliocene (5.3–2.4 mya).

SNP-based genetic structure

After filtering the DArT-called SNP data (43 individuals; 254,287 loci; 35.4% missing data) there were 27,975 SNP sites from all 43 individuals in the D. galeatus species complex (1.78% missing data). Principal co-ordinates analysis with individuals as entities and loci as attributes revealed three tight clusters (Fig. 3A). Two of these corresponded to D. galeatus (n = 16) and D. fyfei sp. nov. (n = 12) and were mainly separated along axis 2 (32.6% of total variation). The other cluster and a single outlier corresponded to north (n = 14) and south (n = 1) MacDonnell Ranges populations of D. tjoritjarinya sp. nov. separated along axis 1 (37.6% of total variation). The percentage of loci with fixed differences between the well-sampled lineages (n >10) ranged from 7.9% (D. tjoritjarinya sp. nov. vs D. galeatus) to 10.4% (D. tjoritjarinya sp. nov. vs D. fyfei sp. nov.) and was significant in all cases (Table 3).

Figure 3.

Results of analyses of DArT-generated SNP data for the Diplodactylus galeatus species complex, including D. galeatus (n = 16), D. fyfei sp. nov. (n = 12), D. tjoritjarinya sp. nov. southern ESU (n = 1), and D. tjoritjarinya sp. nov. northern ESU (n = 14). A Population clusters identified with Principal Coordinates Analysis (PCoA), B Maximum likelihood tree estimated with IQ-TREE, and C Population cluster analyses in STRUCTURE and ADMIXTURE.

Table 3.

Download as

CSV

XLSX

Fixed allelic differences between the three main clades in the Diplodactylus galeatus species complex based on SNP data.

Comparison	FD	No. loci	% FD	p value
Diplodactylus tjoritjarinya sp. nov. vs. D. fyfei sp. nov.	2916	27975	10.4	0.00
D. tjoritjarinya sp. nov. vs. D. galeatus sp. nov.	2198	27975	7.9	0.00
D. fyfei sp. nov. vs. D. galeatus sp. nov.	2443	27975	8.7	0.00

Population cluster analyses in STRUCTURE and ADMIXTURE recovered the optimal number of clusters as K = 3, splitting the data into north, central, and southern populations (Figs 3C, S1). The grouping of a single sample from Watarrka National Park (D. tjoritjarinya sp. nov. south) was consistently problematic. It grouped with the northern population in STRUCTURE without admixture, however in STRUCTURE and ADMIXTURE analyses that allowed admixture it consistently appeared admixed between all three populations (Fig. 3C).

Morphology

The PCA of allometry-corrected morphometric characters revealed substantial overlap between the three species but some evidence of diverging characters in D. fyfei sp. nov. and D. tjoritjarinya sp. nov. (Fig. 4).

Figure 4.

A A PCA plot of allometry-corrected morphometric data for the three gecko species in the Diplodactylus galeatus group, and variation in allometry-corrected morphological characters across the three Diplodactylus galeatus species group species for: B ear opening, C rostral scale height, and D arm length. All characters were originally measured in millimetres to the nearest 0.1 mm.

Mean morphometric values showed little variation across the three populations, with the exception of ear opening width (Fig. 4; Tables S3, S4). Analysis of allometry-corrected ear opening width confirmed that this character differed across populations (F₂ = 86.19, p < 0.001), with the opening on D. tjoritjarinya sp. nov. being significantly smaller than both D. fyfei sp. nov. (p = 0.001) and D. galeatus (p <0.001), and D. fyfei sp. nov. was also significantly smaller than D. galeatus (p = 0.009). Allometry-corrected rostral scale height differed across populations (F₂ = 12.49, p < 0.001), with rostral height significantly larger in D. fyfei sp. nov. than in both D. galeatus (p < 0.001) and D. tjoritjarinya sp. nov. (p = 0.001). Standardised arm length (ArmL) differed across populations (F₂ = 8.67, p < 0.001), with D. tjoritjarinya sp. nov. having significantly shorter arm length compared with D. galeatus (p = 0.046) and D. fyfei sp. nov. (p < 0.001).

There was also variation in pattern and colouration between D. tjoritjarinya sp. nov. and the two southern species. In D. tjoritjarinya sp. nov., the pale dorsal blotches always extend ≤1/4 down the torso of the animal (median = 1/8 down sides) when viewed in lateral profile, versus usually extending ≥1/4 down the torso in the southern populations (median D. galeatus = 1/3, median D. fyfei sp. nov. = 1/4) (Fig. 5). Animals with a continuous vertebral stripe accounted for 9.7% of specimens across the southern populations but were absent from D. tjoritjarinya sp. nov. The pale dots in the lateral regions of D. tjoritjarinya sp. nov. are small (≤3 scales in diameter) and usually not arranged in longitudinal rows (Fig. 5E,F). In contrast, D. galeatus and D. fyfei sp. nov. always have at least a few larger pale dots (>3 scales in diameter; Fig. 5A–D) and these are typically arranged in a mid-lateral row of ‘portholes’. The background dorsal and upper lateral colouration in D. galeatus and D. fyfei sp. nov. is typically a dark red (Fig. 5A–D) versus pinkish-red or reddish-brown in D. tjoritjarinya sp. nov. (Fig. 5E,F).

Figure 5.

Colour-pattern variation in the Diplodactylus galeatus species complex: A, B Diplodactylus galeatus from Coober Pedy, SA (P. McDonald, A. Fenner), C, D Diplodactylus fyfei sp. nov. from foothills of Mt Beddome on New Crown Station, NT (P. McDonald, A. Fenner); E, F D. tjoritjarinya sp. nov. from Tjoritja National Park, Northern Territory (P. McDonald).

Climate niche space

The main lineages in the Diplodactylus galeatus species complex inhabit distinct bioclimatic spaces, with D. galeatus occupying drier areas with less evapotranspiration, D. tjoritjarinya sp. nov. occurring in areas with both higher rainfall and evapotranspiration, and D. fyfei sp. nov. occupying an intermediate space but still with far less rainfall than D. tjoritjarinya sp. nov. (Fig. 6A). The three bioregions are positioned along a latitudinal gradient with the two occupied bioregions at either end and the uninhabited Finke bioregion in the middle (Fig. 6B). This latitudinal gradient was also reflected in the aridity measures, with the southern Stony Plains the most arid region, the northern MacDonnell Ranges the least arid, and the Finke intermediate between the two (Fig. 6C). The areas inhabited by D. fyfei sp. nov. and D. galeatus were more arid than the uninhabited regions to the north of their respective distributions.

Figure 6.

Climate space as measured by annual rainfall and annual potential evapotranspiration: A across point locations for the three main Diplodactylus galeatus complex populations and 1000 randomly selected points across and between their distributions, B at 1000 random points across the two biogeographic regions (Stony Plains and MacDonnell Ranges; Thackway and Cresswell 1995) occupied by the Diplodactylus galeatus complex and the intervening Finke bioregion, with fitted regression lines and 95% confidence intervals, and C aridity as measured by the ratio of rainfall to potential evapotranspiration across the three bioregions (red dashed line shows the boundary between ‘arid’ (>0.03 to <0.2) and ‘semi-arid’ (>0.2 to <0.5; Whitford and Duval 2020).

Systematics

Both the SNP and mtDNA datasets strongly support the reciprocal monophyly of the main isolated populations in the D. galeatus complex, providing evidence of historical independence. Evolutionary independence was further supported by fixed differences across thousands of loci between these populations. The observed mitochondrial genetic differences (p distances) between the three main isolate populations (9–12%) exceeds several Diplodactylus species pairs including: D. capensis and D. granariensis (8.3%), D. capensis and D. nebulosus (8.4%), D. granariensis and D. nebulosus (8.5%), and D. polyophthalmus and D. lateroides (8.5%) (Doughty and Oliver 2013). However, it is also worth noting that some widespread populations that are considered conspecific in other Diplodactylus also show divergences of this level (e.g., Diplodactylus conspicillatus; Oliver et al. 2009), emphasising that caution must be exercised when using mtDNA divergence yardsticks. While there is evidence that the three main isolate populations are diverging morphologically, there was overlap between populations for most characters. Diplodactylus galeatus and D. fyfei sp. nov. are usually diagnosable on the basis of standardised rostral scale height but are indistinguishable based on colour or pattern. Diplodactylus tjoritjarinya sp. nov. is readily diagnosed on the basis of pattern and usually diagnosable on ear width.

In this case, while morphological datasets and mtDNA only offer partial support for species recognition, with additional evidence for reciprocal monophyly and long-term absence of geneflow from multiple datasets, we argue that all three main isolate populations are recognisable as species under the generalised lineage concept.

We do not recognise the southern MacDonnell Ranges population as a separate species given poor coverage of genetic sampling, associated uncertainty about where these lineages might meet, lack of morphological divergence and slightly lower inferred mtDNA differentiation. Analyses of population structuring based on SNP data also struggled to place this population, likely because it is both somewhat divergent and poorly sampled. Given current knowledge, we split D. tjoritjarinya sp. nov. into northern and southern Evolutionary Significant Units (ESUs; Moritz 1994). The northern ESU includes all of the northern part of the MacDonnell Ranges IBRA region east and west of Alice Springs. The southern ESU is confirmed from the George Gill Range and presumably includes other sandstone ranges of the southern MacDonnell Ranges IBRA region but this needs confirmation with further genetic sampling, particularly near Hermannsburg.

Following Kaiser et al. (2013), position statements from the Australian Society of Herpetologists (ASH 2016), and in accordance with a large number of active herpetofaunal taxonomists (Wüster et al. 2021), we do not consider selected nomenclatural acts in self-published works after 1 January 2000, even if these may have priority under the rules of the International Code of Zoological Nomenclature.

To avoid as much repetition as possible in the descriptions and diagnoses of the taxa in this morphologically conserved group, we provide brief diagnoses for the species complex first, and then present more focused diagnoses and comparisons in the species accounts.

Genus Diplodactylus Gray, 1832

Type species

Diplodactylus vittatus Gray, 1832. A genus of Diplodactylidae (sensu Han et al. 2004) characterised by robust habitus, wide scansors, numerous (typically >5) cloacal spurs, two pairs of cloacal bones and an anteriorly enlarged jugal bone entering floor of lacrimal foramen (Oliver et al. 2007).

Diagnosis of the Diplodactylus galeatus species complex

All three species in the D. galeatus complex can be differentiated from all other Diplodactylus by the following combination of characters: medium size (to 56 mm); robust build and relatively short (44–60% of SVL) thick tail with regular annuli of slightly enlarged tubercles separated by rows of smaller scales; enlarged dorsal scales up to twice diameter of ventral scales; snout rounded in profile; supralabials and infralabials much larger than bordering loreals; rostral scale in contact with nostril; expanded apical lamellae on all digits; top of head pale yellowish-brown and bordered posteriorly by a rounded dark line; dorsum of body pinkish red to dark red with three to eight dark-edged pale yellowish-brown blotches; and ventral surface uniform white without any pattern.

Species in D. galeatus complex specifically differ from other Australian Diplodactylus as follows: from D. ameyi, D. barraganae, D. bilybara, D. calcicolus, D. capensis, D. conspicillatus, D. custos, D. fuller, D. furcosus, D. galaxias, D. granariensis, D. hillii, D. kenneallyi, D. laevis, D. lateroides, D. mitchelli, D. nebulosus, D. ornatus, D. platyurus, D. polyophthalmus, D. savage, D. tessellatus, D. vittatus, and D. wiru by the presence of a series of pale yellowish-brown, dark-edged dorsal blotches on the body and tail; from the eight species in the D. conspicillatus complex (D. ameyi, D. barraganae, D. bilybara, D. conspicillatus, D. custos, D. hillii, D. laevis, and D. platyurus) by the presence of enlarged supralabials (versus absent) and terminal lamellae on fingers noticeably wider than digit (versus not wider); from D. galaxias, D. kenneallyi, D. pulcher, and D. savagei in having rostral scale in contact with nostril (versus nostril separated from rostral by small scale); from D. calcicolus, D. capensis, D. furcosus, D. granariensis, D. nebulosus, D. vittatus and D. wiru by the supra and infralabial scales being wider than tall (versus approximately square); from D. lateroides and D. polyophthalmus by the presence of dark edges to the dorsal blotches; and from D. mitchelli and D. ornatus by the absence of a continuous vertebral stripe (rarely present in the D. galeatus species complex).

Diplodactylus galeatus Kluge, 1973

Figures 5A,B

Southern mesa gecko

Holotype

SAMA R973, a male collected on the Stuart Range, South Australia (29.92°S, 134.67°E) by H. Greenfield; designated by Kluge (1973).

Diagnosis from other species in the D. galeatus complex

Diplodactylus galeatus may be distinguished from D. tjoritjarinya sp. nov. (see below) by the larger ear opening (usually >6% of head width or ≥0.6 mm in diameter in adults versus usually <6% of head width or ≤0.5 mm in diameter in D. tjoritjarinya sp. nov.), the presence of dorsal blotches descending ≥1/4 distance down torso when animal is viewed in lateral profile (versus typically descending ~1/8 down torso in D. tjoritjarinya sp. nov.), the presence of large white spots (>3 scales in diameter) in the dorso-lateral region often arranged as mid-lateral row of ‘portholes’ (versus smaller spots only), and by the dark red background colouration (versus pinkish red or red-brown). Diplodactylus galeatus may be distinguished from D. fyfei sp. nov. by the smaller relative rostral scale height (usually ≤2.2% of SVL versus usually >2.2% SVL in D. fyfei sp. nov.). Diplodactylus galeatus further differs from the very similar D. fyfei sp. nov. in at least 20 putatively fixed differences in the mitochondrial ND2 locus (see Table 2).

Description

A medium-sized (to 56 mm) Diplodactylus with a robust build; head moderately wide (HeadW/HeadL – mean = 0.65, range = 0.56–0.74) and deep (HeadD/HeadL – mean = 0.44, range = 0.38–0.54); eyes large (OrbL – mean = 3.5 mm, range = 2.8–4.1); external ear opening relatively large (mean headW/ear = 0.08, range = 0.04–0.11). Supralabials much larger than bordering loreals, wider than high and decreasing in height posteriorly, first supralabial slightly taller or equal in height to second; infralabials 10–12; nostril surrounded by rostral scale, supranasals 2 and postnasals 3–5; relatively low rostral scale (Ros/SVL – mean = 0.021, range = 0.017–0.025), rostral crease usually present and descending one quarter to halfway from top of scale; mental scale lanceolate in shape and always longer than wide.

Scales on dorsum enlarged, up to twice diameter of those on lateral and ventral surfaces; dorsal head scales larger relative to neighbouring sides of head; scales on throat small and granular. Subdigital lamellae in single row of enlarged rounded scales; apical pad pair prominent and enlarged, much wider than proximal width of digit. Males have 3–7 cloacal spurs (median 5); females have rounded scales where the male spurs occur. Original tail short (mean Tail%SVL – mean = 0.51, range = 0.45–0.56) and thick, cylindrical, with regular annuli of slightly enlarged tubercles on dorsal and upper lateral surfaces.

Top of head pale and yellowish-brown bordered posteriorly by a rounded dark line, dorsum dark red brown with four to five dark-edged pale blotches (rarely merged to form a continuous vertebral stripe; 14% of individuals) that descend ≥1/4 distance down torso when animal is viewed in lateral profile, lateral region of torso with numerous white dots (including some >3 scales wide) and frequently arranged in mid-lateral row, limbs usually with scattered white spots, and ventral surface white.

Particulars of holotype

SAMA R973 adult male (all measurements in millimetres): SVL = 52.7, TrunkL = 23.4, TailL = 27.0, TArmL = 20.3, TlegL = 25.0, HeadL = 14.8, HeadW = 10.4, RosCre = 0.0, SupNas = 2, SupLab = 9, InfLab = 11, Cspurs = 6, 4Flam = 7; 4Tlam = 8.

Etymology

Derived from the Latin word galea meaning covered with a helmet in reference to the dark occipital cap.

Distribution and ecological notes

Endemic to South Australia and restricted to the western Stony Plains IBRA region (Thackway and Creswell 1995). Recorded from Prominent Hill in the south, north to approximately 15 km north of Iwantja and east to near Old Peake Telegraph Station.

Occurs on and around dissected tablelands or ‘breakaway’ hills with sparse tussock grass and lower shrub layers and a very sparse Acacia shrub overstory. Observed to be abundant in some areas of its range, with large numbers of specimens observed in a relatively short period of spotlighting in the Breakaways near Coober Pedy (P. Oliver pers. obs.). Recorded in syntopy with Gehyra versicolor and Heteronotia binoei.

Suggested IUCN Red List status

Diplodactylus galeatus has a moderately large range (EOO 23,012 km²) spanning areas that are sparsely inhabited, not subject to widespread habitat destruction or disturbance and including several protected areas (6.96% of the Stony Plains bioregion). Based on these data we suggest that it be considered Least Concern.

Diplodactylus fyfei sp. nov.

https://zoobank.org/4F60C5E3-F132-4302-81E3-AE56AF5F949D

Figures 5C, D, S2

Fyfe’s mesa gecko

Holotype

NTM R39440, a male collected in the foothills east of Mt Beddome on New Crown Station (25.78252°S, 134.35169°E) by P. McDonald on 3^rd December 2023.

Paratypes

NTM R39439, female, foothills east Mt Beddome, New Crown Station, NT (25.78252°S, 134.35169°E); NTM R39441, female, foothills near Mt Beddome, New Crown Station, NT (25.78252°S, 134.35169°E); SAMA R25851, male, Eringa Station, SA (26.28°S, 134.72°E); SAMA R47003, female, 10 km WSW of Mosquito Camp Dam, New Crown Station, SA (26.1606°S, 134.3997°E).

Referred material

NTM R39442, foothills east of Mt Beddome, New Crown Station, NT (25.78252°S, 134.35169°E); NTM R39443–4, foothills of Mt Beddome, New Crown Station, NT (–25.78122°S, 134.36182°E); SAMA R25852, Eringa Station, SA (26.28°S, 134.72°E); SAMA R47002, 10 km WSW of Mosquito Camp Dam, New Crown Station, SA (26.1606°S, 134.3997°E); SAMA R47004, 10 km WSW of Mosquito Camp Dam, New Crown Station, SA (26.1606°S, 134.3997°E).

Diagnosis from other species in the D. galeatus complex

Diplodactylus fyfei sp. nov. may be distinguished from D. tjoritjarinya sp. nov. (see below) by the presence of dorsal blotches descending ≥1/4 distance down torso when animal is viewed in lateral profile (versus typically descending ~1/8 down torso in D. tjoritjarinya sp. nov.), the presence of large white spots (>3 scales in diameter) in the dorso-lateral region often arranged as mid-lateral row of ‘portholes’ (versus smaller spots only), and by the dark red background colouration (versus pinkish red or red-brown). Diplodactylus fyfei sp. nov. may be distinguished from D. galeatus by the larger relative rostral scale height (usually >2.2% of SVL versus usually ≤2.2% SVL in D. galeatus). Diplodactylus fyfei sp. nov. further differs from the very similar D. galeatus in at least 20 putatively fixed differences in the mitochondrial ND2 locus (see Table 2).

Description

A medium-sized Diplodactylus (to 53 mm) with robust build; head moderately wide (HeadW/HeadL – mean = 0.66, range = 0.58–0.76) and deep (HeadD/HeadL – mean = 0.45, range = 0.38–0.52); eyes large (OrbL – mean = 3.4 mm, range = 2.3–3.8); external ear opening relatively large (mean HeadW/Ear = 0.06, range = 0.05–0.08). Supralabials, 8–10, much larger than bordering loreals, wider than high and decreasing in height posteriorly, first supralabial slighty taller or equal in height to second; infralabials 10–12; nostril surrounded by rostral scale, supranasals 2 and postnasals 3–5; relatively high rostral scale (Ros/SVL – mean = 0.023, range = 0.021–0.028), rostral crease usually present and descending one quarter to halfway from top of scale; mental scale lanceolate in shape and always longer than wide.

Scales on dorsum enlarged, up to twice diameter of those on lateral and ventral surfaces; head scales larger relative to neighbouring sides of head; scales on throat small and granular. Subdigital lamellae in single row of enlarged rounded scales; apical pad pair prominent and enlarged, much wider than proximal width of digit. Males have 5–6 cloacal spurs (median 5); females have rounded scales where the male spurs occur. Original tail short (mean Tail/SVL – mean = 0.52, range = 0.47–0.60) and thick, cylindrical, with regular annuli of slightly enlarged tubercles on dorsal and upper lateral surfaces.

Top of head pale and yellowish-brown bordered posteriorly by a rounded dark line, dorsum of dark red brown with 4–5 (median = 5) dark-edged pale blotches (rarely merged to form a continuous vertebral stripe; 9% of individuals) that descend ≥1/4 distance down torso when animal is viewed in lateral profile, lateral region of torso with numerous white dots (including some >3 scales wide) and frequently arranged in mid-lateral row, limbs usually with scattered white spots, dorsal colouration and pattern continue onto original tail (with 2–5 blotches), and ventral surface white.

Particulars of the holotype

An adult male (Fig. S2). SVL = 46.9, TrunkL = 19.6, TailL = 26.5, TailW = 5.8, ArmL = 8.3, LegL = 9.6, HeadL = 15.1, HeadW = 10., HeadD = 7.7, IO = 7.4, NarEye = 4.5, Internar = 1.6, Ros = 1.1, RosCre = 0.4, MentalL = 1.6, MentalW = 1.2, SupNas = 2, SupLab = 13, InfLab = 12, CSpurs = 5, 4FLam = 6, 4TLam = 10, No. SC = 49. Rostral scale height relatively large (2.3% of SVL). Five pale dorsal blotches present on body and extending up to 1/3 down torso when viewed in lateral profile. Large white spots (>3 scale in diameter) present on dorso-lateral region and arranged as mid-lateral row of ‘portholes’.

Etymology

Named for the pioneering herpetologist Greg Fyfe in recognition of his substantial contribution to the knowledge and conservation of central Australia’s reptile fauna.

Distribution and ecology

Restricted to extreme northern Stony Plains IBRA region (Thackway and Cresswell 1995) straddling the Northern Territory/South Australia border. Records in the Northern Territory are associated with Beddome Range on New Crown Station. Potentially suitable habitat also occurs further west on Umbeara and Tieyon Stations in NT and SA, respectively.

Recorded nocturnally active on the ground in and around dissected tablelands or mesas on sandstone and shale geologies. Vegetation usually includes a sparse tussock grass and lower shrub layers and a very sparse Acacia shrub overstory. Usually observed perched atop rocks rather than actively foraging and one individual was encountered in a low shrub (Eremophila freelingii) (P. McDonald pers. obs.). Recorded in syntopy with Gehyra versicolor, Heteronotia binoei and Underwoodisaurus milii.

Suggested IUCN Red List status

Diplodactylus fyfei sp. nov. has the smallest distribution of the three taxa in the D. galeatus species complex (EEO = 654 km²) and has not been recorded from any protected areas. However, it is likely that further sampling in areas of dissected tableland along the NT/SA border to the west will increase its known range. Further, the areas inhabited by Diplodactylus fyfei sp. nov. are sparsely inhabited and have not been subjected to widespread habitat destruction or disturbance. Based on these data we suggest that it be considered Least Concern.

Diplodactylus tjoritjarinya sp. nov.

https://zoobank.org/1F6C6E53-0A54-455D-A05A-AE050D3FDDC0

Figures 5E, F, S2

Tjoritja gecko

Holotype

NTM R20862, a male collected in Alice Springs (23.7°S, 133.87°E) by P. Horner on 16^th October 1990.

Paratypes

NTM R20865, male, Alice Springs (23.7°S, 133.87°E); SAMA R38848, female, junction of Larapinta and Namatjira Drives (23.77°S, 133.15°E); SAMA R38861, male, Junction Waterhole 10 km north of Alice Springs (23.62°S, 133.88°E); SAMA R40591, male, Upper Stokes Creek, Watarrka National Park (–24.28°S, 131.68°E).

Referred material

NTM R15378, 6 km SSW of Claraville Homestead, NT (–23.417°S, 134.726°E); NTM R15795, 4 km SSE of Southern Cross Bore, Garden Station, NT (–23.417°S, 134.726°E); NTM R32488, Palm Valley Well No., NT (–24°S, 132.65°E); NTM R32489, Alice Springs, NT (–23.7°S, 133.883°E); NTM R32492–4, Alice Springs, NT (–23.7°S, 133.867°E).

Diagnosis from other species in the D. galeatus complex

Diplodactylus tjoritjarinya sp. nov. may be distinguished from D. galeatus and D. fyfei sp. nov. by the smaller ear opening (usually ≤5% of head width or ≤0.6 mm in diameter in adults versus usually >6% of head width or ≥0.6 mm in diameter in adult D. galeatus and D. tjoritjarinya sp. nov.), the presence of dorsal blotches descending <1/4 and typically ~1/8 distance down torso when animal is viewed in lateral profile (versus typically descending ≥1/4 down torso in D. galeatus and D. fyfei sp. nov.), the absence of large white spots (>3 scales in diameter) in the dorso-lateral region, and by the pinkish red or red-brown background colouration (versus dark red).

Description

A medium-sized Diplodactylus (to 56.2 mm) with robust build; head moderately wide (HeadW/HeadL – mean = 0.66, range = 0.5–0.81) and deep (HeadD/HeadL – mean = 0.47, range = 0.4–0.54); eyes large (OrbL – mean = 3.5, range = 2.7–4.3); external ear opening relatively small (mean HeadW/ear = 0.05, range = 0.02–0.07). Supralabials much larger than bordering loreals, 8–10, wider than high and decreasing in height posteriorly, first supralabial slightly taller or equal in height to second; 10–12 infralabials; nostril surrounded by rostral scale, 2 supranasals and 3–5 postnasals; relatively low rostral scale (Ros/SVL – mean = 0.021, range = 0.015–0.032), rostral crease usually present and descending one quarter to two thirds down from top of scale; mental scale lanceolate in shape and usually longer than wide.

Scales on dorsum enlarged, up to twice diameter of those on lateral and ventral surfaces; dorsal head scales larger relative to neighbouring sides of head; scales on throat small and granular. Subdigital lamellae in single row of enlarged rounded scales; large apical pads, much wider than proximal width of digit. Males have 3–10 cloacal spurs (median 5); females have rounded scales where the male spurs occur. Original tail short (mean Tail/SVL – mean = 0.52, range = 0.44–0.57) and thick, cylindrical, covered dorsally with regular annuli of slightly enlarged tubercles.

Top of head pale yellowish-brown and bordered posteriorly by a rounded dark line, dorsum of body pinkish red to red-brown with 3–8 (median = 5) dark-edged pale yellowish-brown blotches that descend <1/4 distance down torso when animal is viewed in lateral profile, lateral region of torso with numerous irregular white dots 1–3 scales wide, dorsal colouration and pattern continue onto original tail (with 2–5 blotches), and ventral surface white.

Particulars of the holotype

An adult male (Fig. S2). SVL = 44.2, TrunkL = 24.7, TailL = 24.0, TailW = 4.4, ArmL = 7.1, LegL = 8.7, HeadL = 12.4, HeadW = 8.8, HeadD = 6.6, IO = 7.4, NarEye = 3.4, Internar = 1.5, Ros = 0.9, RosCre = 0.6, MentalL = 1.5, MentalW = 1.2, SupNas = 2, SupLab = 13, InfLab = 11, CSpurs = 5, 4Flam = 7; 4TLam = 9, No. SC = 52. Six pale dorsal blotches present on body and extending <1/8 down torso when viewed in lateral profile. Irregular pattern of small white dots (<3 scales wide) on dorso-lateral region.

Etymology

Tjoritja is a Western and Central Aranda name for the MacDonnell Ranges. Aranda people sometimes refer to themselves as Tjoritja-rinya (pronounced ‘choor-it-ja-rin-ya’) – meaning belonging to Tjoritja. This name respects that Tjoritja is a living cultural landscape to which this gecko belongs and was suggested as a name for this gecko by the Traditional Owners of Tjoritja National Park. Used as a noun in apposition.

Distribution and ecology

Endemic to the Northern Territory and restricted to the MacDonnell Ranges IBRA region (Thackway and Cresswell 1995). The distribution includes the James and Krichauff Ranges in the south, as far southwest as the George Gill Range, east to the Hale River about 40 km southeast of Ruby Gap Nature Park, northeast to the Harts Range area, and north west to at least Ormiston Gorge in Tjoritja National Park. Recorded at elevations ranging from 416–1102 m a.s.l.

Nocturnally active on the ground on rocky substrates and geology types that include sandstone, limestone, gneiss, quartzite, and conglomerate. Landforms include low rolling hills, stony flats and rugged mountain ranges, with hummock or tussock grassland vegetation, usually with a sparse Acacia or mallee Eucalyptus shrub layer.

Individuals have been observed emerging from small invertebrate burrows at dusk and have also been found sheltering underneath small rocks during the day in cool weather (P. McDonald pers. obs). Frequently observed perched atop small loose or partially embedded rocks rather than actively foraging, suggesting an ambush predation foraging mode. Absent from exposed rock faces and escarpments. Recorded in syntopy with Crenadactylus horni, Diplodactlyus conspicillatus, Gehyra versicolor, Heteronotia binoei, Nephrurus amyae, and Rhynchoedura ornata (P. McDonald pers. obs.). Appears to be absent from large boulders, rock faces and escarpments inhabited by the saxicoline Central Ranges endemic geckos Gehyra moritzi, Heteronotia fasciolatus, Oedura cincta, and O. luritja.

Suggested IUCN Red List status

Diplodactylus tjoritjarinya sp. nov. has a moderate range size (estimated EOO 9365 km²) spanning areas that are not subject to widespread habitat destruction or disturbance and including several protected areas (e.g., Tjoritja National Park; terrestrial protected areas comprise 14.2% of the MacDonnell Ranges IBRA). Recent attempts to locate D. tjoritjarinya sp. nov. in areas with dense Buffel grass (Cenchrus ciliaris) near Alice Springs have failed, suggesting this invasive species impacts habitat suitability for the species (P. McDonald pers. obs.). However, Buffel grass is a minor floristic component across most suitable habitats for D. tjoritjarinya sp. nov. (including both ESU’s). Based on these data we suggest that it be considered Least Concern, but the potential impact of Buffel grass on habitat suitability may warrant further investigation.

Discussion

Climatic relicts or ecological relicts?

The distribution of the D. galeatus species complex spans two regions with differing climates and thus provided a unique opportunity to examine two potential mechanisms of population isolation in an arid zone lineage – climatic refugia versus ecological specialisation.

With a distribution entirely restricted to the relatively mesic uplands of the MacDonnell Ranges IBRA region, D. tjoritjarinya sp. nov. outwardly fits the climate refugia model. However, the closely related D. galeatus and D. fyfei sp. nov. are restricted to the truly arid Stony Plains IBRA region. The Finke IBRA region, which spans the gap between D. tjoritjarinya sp. nov. and the southern species as well the western gap between the two southern species, is less arid than the Stony Plains and thus does not pose an obvious climatic barrier for the species complex. Microhabitat use in the D. galeatus species complex also points to a distribution pattern decoupled from climatic refugia. Specifically, none of the D. galeatus complex are known to use deep gorges or rock crevices that likely to afford a microclimatic buffer from extreme aridity. Instead, they tend to be associated with sparsely vegetated rocky slopes. Within this habitat they have been recorded using small invertebrate (e.g., spider) burrows as diurnal shelter and their occurrence may be more limited by the presence of small rocks on which to perch when active rather than the availability of daytime shelter (Fig. 1B). Our observations also provide no evidence that activity is limited by warm conditions and we have found them active in the evening at temperatures of >34°C. These data suggest that evolutionary retreat from intensifying aridity, in and of itself, does not explain vicariance in this gecko clade.

The alternative hypothesis for the isolation of the D. galeatus species complex into three main populations is that, like many arid zone geckos (Heinicke et al. 2017), they have specialised to use a formerly more widespread substrate that has been sundered by environmental change. Diplodactlyus tjoritjarinya sp. nov. and D. fyfei sp. nov. are separated by about 250 km of the Finke IBRA region. Potentially suitable dissected tableland habitat occurs along the Finke River, but these tablelands are generally small and isolated (Wells 1969). One possibility is that suitable stony habitat linking these isolated tablelands has been covered by the sand dunes which are a dominant contemporary landscape feature of this region. However, the formation of these sand dunes has been dated to ca. 1 mya (Fujioka et al. 2009) which postdates our estimates for timing of isolation of these geckos across this area.

An alternative possible explanation of vicariance in the D. galeatus complex is that landform erosion has removed dissected tablelands that formerly linked the MacDonnell Ranges with the Beddome Range. In support of this hypothesis, Fujioka et al. (2005) found that global cooling ca. 4 mya initiated the stripping of soil mantles from silcrete tablelands in northern South Australia, which was followed by a period of active tableland erosion commencing 3 mya and slowing during the past 2 mya (Fujioka et al. 2005). Loss of connecting dissected tableland also potentially explains the isolation of D. fyfei sp. nov. from D. galeatus, with the area between about Oodnadatta and Mt Dare now mostly comprising unsuitable pavement gibber desert (Brandle 1998). This period of active erosion 2–3 mya is consistent with our estimated timing of divergence of the D. galeatus species complex during the Plio-Pleistocene. For further testing of the hypothesis of Plio-Pleistocene loss of tableland habitat, comparative genetic analyses of two threatened species with similar distributions could be invaluable. Namely, the pygopod gecko Ophidiocephalus taeniatus and the plant Acacia latzii both have relictual distributions restricted to dissected tablelands across disjunct areas (Nano et al. 2007; McDonald et al. 2012; Pedler et al. 2014).

We have been unable to find any commentary on what the drivers of the afore-mentioned widespread erosion in the Pliocene was. Paleoclimatic data from the Nullarbor deserts of southern Australia show that the early Pliocene corresponds with a mesic reversal (Sniderman et al. 2016). These data could suggest the intriguing idea that for the D. galeatus complex at least, landform erosion associated with a relatively mesic phase may have set in train isolation and divergence across the arid zone. However, current estimates for the timing of this mesic pulse (~3.5 mya) predate estimates for the onset of major landform erosion in the stony desert (2–3 mya). One potential explanation that would unify these two signals is that rates of erosion accelerated with the loss of stabilising vegetation at the end of the Pliocene wet pulse. This remains speculative and there is considerable uncertainty about processes, however, the emergent patterns shown by the D. galeatus complex certainly differ from the classic mesic refugial model of vicariance for Australia’s central uplands. This further emphasises how outwardly comparable patterns of distribution in taxa from arid ranges may be linked to a varying suite of climatic and ecological histories (Oliver and McDonald 2016).

Cryptic diversity, short-range endemism and conservation

Species in the D. galeatus complex show only slight morphological variation and SNP data were critical to testing the hypothesis of evolutionary independence. Work on geckos in the genus Gehyra from the AAZ in Western Australia has revealed a remarkable plethora of morphologically conservative taxa largely associated with stable upland areas (Doughty et al. 2018), and work on dragons in the genus Tympanocryptis has also revealed complexes of parapatric cryptic species in the AAZ (Melville et al. 2014). It seems certain that comprehensive genetic analyses will continue to reveal additional instances of cryptic speciation and overlooked short-range endemics in the AAZ, especially in substrate-specialist taxa associated with stable landforms such as mountains and other upland areas. In this context we are aware of at least two other deeply divergent and as yet undescribed species of Diplodactylus that are also associated with upland landforms around the periphery of Australia’s arid zone (Oliver pers. obs.).

The ongoing dismemberment of widespread taxa into complexes of more restricted range endemics also necessitates re-evaluation of conservation statuses. Recent attempts to locate D. tjoritjarinya sp. nov. in areas with dense Buffel grass (Cenchrus ciliaris) near Alice Springs have failed, suggesting this invasive species impacts habitat suitability for the gecko (P. McDonald pers. obs.). However, Buffel grass is a minor floristic component across most suitable habitats for D. tjoritjarinya sp. nov. (including both ESU’s; P. McDonald pers. obs.) and is thus unlikely to pose a serious conservation risk to the species, at least in the medium term. The extent of occurrence of D. fyfei sp. nov. (EOO = 654 km²) is also very small. Fortunately, our data suggest it is likely well adapted to climatic extremes, and it also occurs in an area that is sparsely inhabited and has not been subject to widespread habitat destruction or disturbance.

Acknowledgements

Costs of generating DArT data were partially underwritten by Bioplatforms Australia as part of the Australian Amphibian and Reptile genomes project. The traditional owners of Tjoritja National Park and Martin Campbell from the Central Land Council assisted with the naming of the MacDonnell Ranges population. The Costello and McKay families allowed access to their properties for sampling in the southern NT. We thank Sally South for providing access to tissues in her care, Domenic Capone and Mark Hutchinson from SAMA, and Gavin Dally, Adam Yates, Samuel Arman, and Dan Edwards from NTM, for assisting with the loan of specimens.

References

Alexander DH, Novembre J, Lange K (2009) Fast model-based estimation of ancestry in unrelated individuals. Genome Research 19: 1655–1664. https://doi.org/10.1101/gr.094052.109

ASH (2016) Position of the Australian Society of Herpetologists on the increasing proliferation of names for taxa without adequate diagnosis or description and published without the benefits of peer review. (Australian Society of Herpetologists Inc., Position Statement, No. 2). https://static1.squarespace.com/static/5448a9abe4b0ad6dc5e6fe6d/t/577e45a029687fd477a8375a/1467893157321/ASH_taxonomic_position_statement.pdf [accessed on 15 January 2024].

Ashman LG, Bragg JG, Doughty P, Hutchinson MN, Bank S, Matzke NJ, Oliver P, Moritz C (2018) Diversification across biomes in a continental lizard radiation. Evolution 72: 1553–1569. https://doi.org/10.1111/evo.13541

Bauer AM, Jackman T, Sadlier RA, Whitaker AH (2006) A revision of the Bavayia validiclavis group (Squamata: Gekkota: Diplodactylidae), a clade of New Caledonian geckos exhibiting microendemism. Proceedings California Academy of Sciences 57: 503–547.

Bouckaert R, Heled J, Kühnert D, Vaughan T, Wu CH, Xie D, Suchard MA, Rambaut A, Drummond AJ (2014) BEAST 2: A software platform for Bayesian evolutionary analysis. PLoS Computational Biology 10: e1003537. https://doi.org/10.1371/journal.pcbi.1003537

Brandle R (1998) A Biological Survey of the Stony Deserts, South Australia. Department for Environment, Heritage and Aboriginal Affairs, Adelaide, 395 pp.

Brennan IG, Oliver PM (2017) Mass turnover and recovery dynamics of a diverse Australian continental radiation. Evolution 71: 1352–1365. https://doi.org/10.1111/evo.13207

Byrne M, Yeates DK, Joseph L, Kearney M, Bowler J, Williams MAJ, Cooper S, Donnellan SC, Keogh JS, Leys R, Melville J (2008) Birth of a biome: Insights into the assembly and maintenance of the Australian arid zone biota. Molecular Ecology 17: 4398–4417. https://doi.org/10.1111/j.1365-294X.2008.03899.x

Chan KO, Grismer LL (2022) GroupStruct: An R package for allometric size correction. Zootaxa 5124: 471–482. https://doi.org/zootax10.11646/.5124.4.4

Couper PJ, Oliver PM (2016) A new species of gecko from arid inland regions of eastern Australia (Diplodactylus; Diplodactylidae). Zootaxa 4093: 525–538. https://doi.org/10.11646/zootaxa.4093.4.4

Crisp MD, Laffan S, Linder HP, Monro A (2001) Endemism in the Australian flora. Journal of Biogeography 28: 183–198. https://doi.org/10.1046/j.1365-2699.2001.00524.x

de Queiroz K (2007) Toward an integrated system of clade names. Systematic Biology 56: 956–974. https://doi.org/10.1080/10635150701656378

Donnellan SC, Catullo RA, Rowley JJL, Doughty P, Price L, Hine HB, Richards SJ (2023) Revision of Litoria rothii (Anura: Pelodryadidae) from northern Australia. Zootaxa 5352: 73–108. https://doi.org/10.11646/zootaxa.5352.1.3

Doughty P, Bauer AM, Pepper M, Keogh JS (2018) Spots before the eyes: Revision of the saxicoline geckos of the Gehyra punctata (Squamata: Gekkonidae) species complex in the Pilbara region of Western Australia. Records of the Western Australian Museum 33: 1–50. https://doi.org/10.18195/issn.0312-3162.33(1).2018.001-050

Doughty P, Oliver PM (2013) Systematics of Diplodactylus (Squamata: Diplodactylidae) from the south-western Australian biodiversity hotspot: Redefinition of D. polyophthalmus and the description of two new species. Records of the Western Australian Museum 28: 44–65. https://doi.org/10.18195/issn.0312-3162.28(1).2013.044-065

Doughty P, Pepper M, Keogh JS (2010) Morphological and molecular assessment of the Diplodactylus savagei species complex in the Pilbara region, Western Australia, with a description of a new species. Zootaxa 2393: 33–45. https://doi.org/10.11646/zootaxa.2393.1.3

Edgar RC (2004) MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research 32: 1792–1797. https://doi.org/10.1093/nar/gkh340

Fujioka T, Chappell J, Fifield LK, Rhodes EJ (2009) Australian desert dune fields initiated with Pliocene–Pleistocene global climatic shift. Geology 37: 51–54. https://doi.org/10.1130/G25042A.1

Fujioka T, Chappell J, Honda M, Yatsevich I, Fifield K, Fabel D (2005) Global cooling initiated stony deserts in central Australia 2–4 Ma, dated by cosmogenic 21Ne-10Be. Geology 33: 993–996. https://doi.org/10.1130/G21746.1

Fujita MK, McGuire JA, Donnellan SC, Moritz C (2010) Diversification and persistence at the arid-monsoonal interface: Australia-wide biogeography of the Bynoe’s gecko (Heteronotia binoei; Gekkonidae). Evolution 64: 2293–2314. https://doi.org/10.1111/j.1558-5646.2010.00993.x

Garcia-Porta J, Simó-Riudalbas M, Robinson M, Carranza S (2017) Diversification in arid mountains: Biogeography and cryptic diversity of Pristurus rupestris rupestris in Arabia. Journal of Biogeography 44: 1694–1704. https://doi.org/10.1111/jbi.12929

Gibson N, Meissner R, Markey AS, Thompson WA (2012) Patterns of plant diversity in ironstone ranges in arid south western Australia. Journal of Arid Environments 77: 25–31. https://doi.org/10.1016/j.jaridenv.2011.08.021

Gonçalves DV, Brito JC, Crochet PA, Geniez P, Padial JM, Harris DJ (2012) Phylogeny of north African agama lizards (Reptilia: Agamidae) and the role of the Sahara desert in vertebrate speciation. Molecular Phylogenetics and Evolution 64: 582–591. https://doi.org/10.1016/j.ympev.2012.05.007

Gray JE (1832) Three new animals brought from New Holland by Mr Cunningham. Proceedings of the Zoological Society of London 1832: 39–40.

Grismer L, Wood P, Poyarkov N, Le M, Karunarathna S, Chomdej S, Suwannapoom C, Qi S, Liu S, Che J, Quah ESH, Kraus F, Oliver PM, Riyanto A, Pauwels OSG, Grismer JL (2021) Karstic landscapes are foci of species diversity in the world’s third-largest vertebrate Genus Cyrtodactylus Gray, 1827 (Reptilia: Squamata; Gekkonidae). Diversity 13: 183. https://doi.org/10.3390/d13050183

Gruber B, Unmack PJ, Berry OF, Georges A (2018) DARTR: An R package to facilitate analysis of SNP data generated from reduced representation genome sequencing. Molecular Ecology Resources 18: 691–699. https://doi.org/10.1111/1755-0998.12745

Heinicke MP, Jackman TR, Bauer AM (2017) The measure of success: Geographic isolation promotes diversification in Pachydactylus geckos. BMC Evolutionary Biology 17: 1–17. https://doi.org/10.1186/s12862-016-0846-2

Han D, Zhou K, Bauer AM (2004) Phylogenetic relationships among gekkotan lizards inferred from C-mos nuclear DNA sequences and a new classification of the Gekkota. Biological Journal of the Linnaean Society 83: 353–368. https://doi.org/10.1111/j.1095-8312.2004.00393.x

Huson DH, Bryant D (2006) Application of phylogenetic networks in evolutionary studies. Molecular Biology and Evolution 23: 254–267. https://doi.org/10.1093/molbev/msj030

Jaccoud D (2001) Diversity arrays: A solid state technology for sequence information independent genotyping. Nucleic Acids Research 29: e25. https://doi.org/10.1093/nar/29.4.e25

Kaiser H, Crother BI, Kelly CMR, Luiselli L, O’Shea M, Ota H, Passos P, Schleip WD, Wüster W (2013) Best practices: In the 21st Century, taxonomic decisions in herpetology are acceptable only when supported by a body of evidence and published via peer-review. Herpetological Review 44: 8–23.

Kluge AG (1963) Three new species of the gekkonid lizard genus Diplodactylus Gray from Australia. Records of the South Australia Museum 14: 545–553.

Kumar S, Stecher G, Li M, Knyaz C, Tamura K (2018) MEGA X: Molecular evolutionary genetics analysis across computing platforms. Molecular Biology and Evolution. 35: 1547–1549. https://doi.org/10.1093/molbev/msy096

McDonald PJ, Jobson P, Köhler F, Nano CEM, Oliver PM (2021) The living heart: Climate gradients predict desert mountain endemism. Ecology and Evolution 11: 4366–4378. https://doi.org/10.1002/ece3.7333

McDonald PJ, Pavey CR, Fyfe G (2012) The lizard fauna of litter mats in the stony desert of the southern Northern Territory. Australian Journal of Zoology 60: 166–172. https://doi.org/10.1071/ZO12068

Melville J, Haines ML, Hale J, Chapple S, Ritchie EG (2016) Concordance in phylogeography and ecological niche modelling identify dispersal corridors for reptiles in arid Australia. Journal of Biogeography 43: 1844–1855. https://doi.org/10.1111/jbi.12739

Melville J, Smith K, Hobson R, Hunjan S, Shoo L (2014) The role of integrative taxonomy in the conservation management of cryptic species: The taxonomic status of endangered earless dragons (Agamidae: Tympanocryptis) in the grasslands of Queensland, Australia. PLoS ONE 9: e101847. https://doi.org/10.1371/journal.pone.0101847

Moritz C (1994) Defining ‘Evolutionarily Significant Units’ for conservation. Trends in Ecology & Evolution 9: 373–375. https://doi.org/10.1016/0169-5347(94)90057-4

Nano C, Harris M, Pavey CR (2007) National recovery plan for threatened Acacias and Ricinocarpos gloria-medii in central Australia. Northern Territory Department of Natural Resources, Environment and the Arts, Alice Springs, 62 pp.

Nguyen LT, Schmidt HA, von Haeseler A, Minh BQ (2015) IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and Evolution 32: 268–274. https://doi.org/10.1093/molbev/msu300

Oliver PM, Adams M, Doughty P (2010) Molecular evidence for ten species and Oligo-Miocene vicariance within a nominal Australian gecko species (Crenadactylus ocellatus, Diplodactylidae). BMC Evolutionary Biology 10: 386. https://doi.org/10.1186/1471-2148-10-386

Oliver PM, Adams M, Lee MSY, Hutchinson MN, Doughty P (2009) Cryptic diversity in vertebrates: Molecular data double estimates of species diversity in a radiation of Australian lizards (Diplodactylus, Gekkota). Proceedings of the Royal Society B 276: 2001–2007. https://doi.org/10.1098/rspb.2008.1881

Oliver PM, Ashman LG, Bank S, Laver RJ, Pratt RC, Tedeschi LG, Moritz CC (2019) On and off the rocks: Persistence and ecological diversification in a tropical Australian lizard radiation. BMC Evolutionary Biology 19: 81. https://doi.org/10.1186/s12862-019-1408-1

Oliver PM, Bauer AM (2011) Systematics and evolution of the Australian knob-tail geckos (Nephrurus, Carphodactylidae, Gekkota): Plesiomorphic grades and biome shifts through the Miocene. Molecular Phylogenetics and Evolution 59: 664–674. https://doi.org/10.1016/j.ympev.2011.03.018

Oliver PM, Couper PJ, Pepper M (2014a) Independent transitions between monsoonal and arid biomes revealed by systematic revison of a complex of Australian geckos (Diplodactylus; Diplodactylidae). PLoS ONE 9: e111895. https://doi.org/10.1371/journal.pone.0111895

Oliver PM, Doughty P (2016) Systematic revision of the marbled velvet geckos (Oedura marmorata species complex, Diplodactylidae) from the Australian arid and semi-arid zones. Zootaxa 4088: 151–176. https://doi.org/10.11646/zootaxa.4088.2.1

Oliver PM, Hugall A, Adams M, Cooper SJB, Hutchinson M (2007) Genetic elucidation of cryptic and ancient diversity in a group of Australian diplodactyline geckos: The Diplodactylus vittatus complex. Molecular Phylogenetics and Evolution 44: 77–88. https://doi.org/10.1016/j.ympev.2019.106589

Oliver PM, McDonald PJ (2016) Young relicts and old relicts: A novel palaeoendemic vertebrate from the Australian central uplands. Royal Society Open Science 3: 160018. https://doi.org/10.1098/rsos.160018

Oliver PM, Prasetya AM, Tedeschi LG, Fenker J, Ellis RJ, Doughty P, Moritz C (2020) Crypsis and convergence: Integrative taxonomic revision of the Gehyra australis group (Squamata: Gekkonidae) from northern Australia. PeerJ 8: e7971. https://doi.org/10.7717/peerj.7971

Oliver PM, Smith KL, Laver RJ, Doughty P, Adams M (2014b) Contrasting patterns of persistence and diversification in vicars of a widespread Australian lizard lineage (the Oedura marmorata complex). Journal of Biogeography 41: 2068–2079. https://doi.org/10.1111/jbi.12364

Pedler R, Brandle R, Fenner A, Lennon S (2014) Limbless geckoes hanging on? Lessons in exploiting arid-zone unpredictability from an elusive habitat-specialist pygopod. Wildlife Research 41: 266–274. https://doi.org/10.1071/WR13217

Pepper M, Doughty P, Arculus R, Keogh JS (2008) Landforms predict phylogenetic structure on one of the world’s most ancient surfaces. BMC Evolutionary Biology 8: 152. https://doi.org/10.1186/1471-2148-8-152

Pepper M, Doughty P, Fujita MK, Moritz C, Keogh JS (2013a) Speciation on the rocks: Integrated systematics of the Heteronotia spelea species complex (Gekkota; Reptilia) from western and central Australia. PLoS ONE 8: e78110. https://doi.org/10.1371/journal.pone.0078110

Pepper M, Doughty P, Hutchinson MN, Keogh SJ (2011a) Ancient drainages divide cryptic species in Australia’s arid zone: Morphological and multi-gene evidence for four new species of Beaked Geckos (Rhynchoedura). Molecular Phylogenetics and Evolution 61: 810–822. https://doi.org/10.1016/j.ympev.2011.08.012

Pepper M, Doughty P, Keogh JS (2006) Molecular phylogeny and phylogeography of the Australian Diplodactylus stenodactylus (Gekkota; Reptilia) species-group based on mitochondrial and nuclear genes reveals an ancient split between Pilbara and non-Pilbara D. stenodactylus. Molecular Phylogenetics and Evolution 41: 539–555. https://doi.org/10.1016/j.ympev.2006.05.028

Pepper M, Doughty P, Keogh JS (2013b) Geodiversity and endemism in the iconic Australian Pilbara region: A review of landscape evolution and biotic response in an ancient refugium. Journal of Biogeography 40: 1225–1239. https://doi.org/10.1111/jbi.12080

Pepper M, Fujita MK, Moritz C, Keogh JS (2011b) Palaeoclimate change drove diversification among isolated mountain refugia in the Australian arid zone. Molecular Ecology 20: 1529–1545. https://doi.org/10.1111/j.1365-294X.2011.05036.x

Pepper M, Keogh JS (2021) Life in the “dead heart” of Australia: The geohistory of the Australian deserts and its impact on genetic diversity of arid zone lizards. Journal of Biogeography 48: 716–746. https://doi.org/10.1111/jbi.14063

R Core Team (2022) R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria.

Renner SS (2016) Return to Linnaeus’s focus on diagnosis, not description: The use of DNA characters in the formal naming of species. Systematic Biology 65: 1085–1095. https://doi.org/10.1093/sysbio/syw032

Sistrom M, Donnellan SC, Hutchinson MN (2013) Delimiting species in recent radiations with low levels of morphological divergence: A case study in Australian Gehyra geckos. Molecular Phylogenetics and Evolution 68: 135–143. https://doi.org/10.1016/j.ympev.2013.03.007

Skipwith PL, Bi K, Oliver PM (2019) Relicts and radiations: Phylogenomics of an Australasian lizard clade with east Gondwanan origins (Gekkota: Diplodactyloidea). Molecular Phylogenetics and Evolution 140: 106589. https://doi.org/10.1016/j.ympev.2019.106589

Sniderman JMK, Woodhead JD, Hellstrom J, Jordan GJ, Drysdale RN, Tyler JJ, Porch N (2016) Pliocene reversal of late Neogene aridification. Proceedings of the National Academy of Sciences 113: 1999–2004. https://doi.org/10.1073/pnas.1520188113

Thackway R, Cresswell ID (1995) An interim biogeographic regionalisation for Australia: A framework for setting priorities in the national reserves system cooperative. Australian Nature Conservation Agency, Canberra, 89 pp.

Thorpe RS (1975) Quantitative handling of characters useful in snake systematics with particular reference to intraspecific variation in the ringed snake Natrix natrix (L.). Biological Journal of the Linnaean Society 7: 27–43. https://doi.org/10.1111/j.1095-8312.1975.tb00732.x

Unmack PJ, Sandoval-Castillo J, Hammer MP, Adams M, Raadik TA, Beheregaray LB (2017) Genome-wide SNPs resolve a key conflict between sequence and allozyme data to confirm another threatened candidate species of river blackfishes (Teleostei: Percichthyidae: Gadopsis). Molecular Phylogenetics and Evolution 109: 415–420. https://doi.org/10.1016/j.ympev.2017.02.013

Wells AT (1969) Finke, NT: Sheet SG/53-6 international index. Australia 1:250,000 Geological Series. Bureau of Mineral Resources, Geology and Geophysics, Canberra.

Whitford WG, Duval BD (2020) Conceptual Framework, Paradigms, and Models. In: Whitford WG, Duval BD (Eds) Ecology of Desert Systems. Elsevier, 1–20. https://doi.org/10.1016/B978-0-12-815055-9.00001-1

Wilson S, Swan G (2017) A Complete Guide to Reptiles of Australia (5^th Edition.). Reed New Holland Publishers, Sydney, 560 pp.

Wüster W, Thomson SA, O’Shea M, Kaiser H (2021) Confronting taxonomic vandalism in biology: Conscientious community self-organization can preserve nomenclatural stability. Biological Journal of the Linnean Society 133: 645–670. https://doi.org/10.1093/biolinnean/blab009

Supplementary materials

Supplementary material 1

Figures S1, S2

McDonald PJ, Fenner AL, Torkkola J, Oliver PM (2024)

Data type: .pdf

Explanation notes: Figure S1. SNPs cluster evaluations in STRUCTURE and ADMIXTURE. — Figure S2. Photographs of the holotypes in the collection of the Museum and Art Gallery of the Northern Territory for Diplodactylus fyfei sp. nov. and D. tjoritjarinya sp. nov..

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.

Download file (591.24 kb)

Supplementary material 2

Tables S1–S4

McDonald PJ, Fenner AL, Torkkola J, Oliver PM (2024)

Data type: .pdf

Explanation notes: Table S1. Details of samples from the Diplodactylus galeatus complex included in genetic analyses. — Table S2. GenBank accession details for all ND2 samples included in Bayesian dating analyses run in BEAST. — Table S3. Summary of characters across the three populations in the Diplodactylus galeatus species complex.— Table S4. Morphometric measurements for individual specimens across the three populations in the Diplodactylus galeatus species complex.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.

Download file (362.69 kb)