Research Article
Print
Research Article
Integrative taxonomic revision of the Goniurosaurus lichtenfelderi group (Squamata: Eublepharidae): Insights from morphological and molecular data
expand article infoShuo Qi, Hai Ngoc Ngo§, L. Lee Grismer|, Hao-Tian Wang, Han-Ming Song, Xiao-Yu Zhu#, Zhu-Qing He#, Zi-Chen Zhou¤«, Pi-Peng Li», Ji-Chao Wang˄, Ying-Yong Wang
‡ Sun Yat-sen University, Guangzhou, China
§ Vietnam Academy of Science and Technology, Hanoi, Vietnam
| La Sierra University, Riverside, United States of America
¶ San Diego Natural History Museum, San Diego, United States of America
# East China Normal University, Shanghai, China
¤ Imperial College London, London, United Kingdom
« Natural History Museum, London, United Kingdom
» Shenyang Normal University, Shenyang, China
˄ Hainan Normal University, Haikou, China
Open Access

Abstract

Understanding the taxonomy of the Goniurosaurus lichtenfelderi group has long been obscured by limited sampling, inconsistent morphological characters, and a lack of publicly available molecular and distribution data. In this study, we conducted the most comprehensive morphological and molecular assessment of this group to date, integrating extensive sampling from Hainan Island and adjacent mainland regions. Phylogenetic analyses using mitochondrial and nuclear genes, along with SNPs delivered from ddRAD-seq, revealed that G. hainanensis is polyphyletic, consisting of two deeply divergent clades (i.e., western and eastern) on Hainan Island. The western clade, from the type locality at Mt. Wuzhi, shows small genetic divergence from G. sinensis (= G. kwanghua), supporting their synonymy. In contrast, the eastern clade is genetically more closely related to the continental G. lichtenfelderi than to its western counterpart. Divergence time estimates further indicate that the eastern and western Hainan populations have distinct evolutionary histories. Based on integrated evidence, we synonymize G. kwanghua and G. sinensis with G. hainanensis, and delimit the eastern Hainan clade as G. cf. lichtenfelderi, pending further morphological confirmation. Consequently, the number of valid species in the G. lichtenfelderi group is revised from five to four (including G. lichtenfelderi, G. hainanensis, G. bawanglingensis, and G. zhoui). In addition, a revised taxonomic account and updated distribution information for all recognized species are provided in this study.

Keywords

ddRAD-seq, Hainan Island, molecular phylogeny, synonym, systematics, tiger geckos

Introduction

Pleistocene sea-level fluctuations repeatedly reshaped geographic landscapes and biogeographic patterns worldwide, periodically connecting and isolating landmasses and thus influencing the distribution and diversification of organisms (Siddall et al. 2003; Clark et al. 2009; Lambeck et al. 2014). Hainan Island, separated from mainland China by the Qiongzhou Strait, underwent multiple episodes of connection and isolation with the Asian continent during these oscillations due to eustatic sea-level changes and the shallow nature of the surrounding seabed. These repeated cycles profoundly shaped the island’s ecosystems and promoted complex evolutionary histories among its biota (Ali et al. 2025). Endemic lineages on Hainan provide valuable opportunities to explore how historical landmass dynamics and intermittent land bridges drive genetic divergence, local adaptation, and even speciation. Among these, the eublepharid geckos of the genus Goniurosaurus Barbour, 1908 exemplify the taxonomic complexities arising from fragmented habitats, cryptic diversity, and conflicting interpretations of morphological and molecular data, representing a microcosm of the broader challenges in reconciling biogeographic hypotheses with species-level systematics.

The genus Goniurosaurus, currently comprises 26 extant species (Grismer et al. 2021; Ngo et al. 2021; Cai et al. 2022; Ngo et al. 2023; Kurita and Toda 2024; Uetz et al. 2025), which occur in three geographically isolated regions: the Ryukyu Archipelago, Japan; the mountainous region of northern Guangdong, China; and an area encompassing Hainan Island, the China-Vietnam border and northern Vietnam, extending northward along the eastern margin of the Yunnan-Guizhou Plateau to southern Guizhou, China. Since the late 20th century, the rise of molecular taxonomy has enabled the identification of cryptic biodiversity and supported the delineation of taxonomic boundaries. Nearly half of the species of Goniurosaurus have been delimited and their morphological diagnoses supported with molecular data over the past decade (Liang et al. 2018; Zhou et al. 2018, 2019; Qi et al. 2020a, 2020b; Zhu et al. 2020a, 2020b, 2021, 2022; Kurita and Toda 2024). The genus Goniurosaurus is a well-diagnosed monophyletic group of the family Eublepharidae, comprising of four species groups confirmed through molecular phylogenetic analyses: the G. kuroiwae, G. lichtenfelderi, G. luii, and G. yingdeensis groups (Liang et al. 2018; Qi et al. 2020a, 2020b; Zhu et al. 2020b; Grismer et al. 2021; Ngo et al. 2021). Most species of Goniurosaurus show a preference to karst habitats, but some species in the G. kuroiwae and G. lichtenfelderi group are not restricted to limestone (karst) environments (Wang et al. 2014; Liang et al. 2018; Qi et al. 2020a, 2020b; Grismer et al. 2021). Grismer et al. (2021) hypothesized that the absence of competitors and/or predators in these insular habitats widened the fundamental niches of their ancestors and allowed some species to become more generalized in their habitat preference. On the other hand, the bedrock composition of oceanic islands is typically dominated by granite and volcanic rock, with relatively little limestone. For instance, on Hainan Island, only about 1200 km² consists of limestone, accounting for just 3.5% of the island’s total land area (China Programme of Kadoorie Farm, Botanic Garden and Hainan Wildlife Conservation Centre of Hainan Provincial Forestry Department 2007). Therefore, after the separation of these islands from the mainland, these species were compelled to expand into a wider range of habitats.

The taxonomy of the G. lichtenfelderi group has remained controversial for decades, with several key issues still unresolved. Mocquard (1897) described Eublepha­ris lichtenfelderi based on two specimens from “Isles de Norway” (= Ba Mun and Cai Lim islands) in the Gulf of Tonkin, Vietnam. Shortly afterwards, Barbour (1908) described G. hainanensis based on a single specimen from “Mt Wuchi” (= Mt Wuzhi), Hainan Island, China, and established the genus Goniurosaurus with G. hainanensis as the type species. Subsequently, Schmidt (1927) noted the similarity between the descriptions of these two species and placed G. hainanensis in the synonymy of E. lichtenfelderi, thereby implicitly synonymizing Goniurosaurus with Eublepharis. This arrangement was followed by Pope (1935), Smith (1935), and Kluge (1967, 1987). Börner (1981) resurrected Goniurosaurus from the synonymy of Eublepharis and presented the new combination G. lichtenfelderi in his self-published non-peer-reviewed journals. Later, Grismer (1987) provided additional evidence for the resurrection of Goniurosaurus and considered G. hainanensis as a subspecies of G. lichtenfelderi based on morphological characters. Orlov and Darevsky (1999) described G. murphyi from northeastern Vietnam based on morphological characters. Subsequently, Grismer (2000) pointed out that Orlov and Darevsky (1999) were misled by an incorrect photo in Zhao and Adler (1993), and that G. murphyi should be considered a junior synonym of G. lichtenfelderi, and G. lichtenfelderi hainanensis should be elevated to a full species. Grismer et al. (2002) described G. bawanglingensis from Hainan Island, China and classified it as a member of the G. luii group based on morphological phylogenetic analysis. Blair et al. (2009) re-evaluated the taxonomic status of G. hainanensis and provided a more comprehensive examination of scale characteristics based on a larger dataset. The results revealed significant differences in several previously described scale counts, which were attributed to the high degree of morphological variability of this genus.

Since the 2010s, recent descriptions of new species using molecular data supported the establishment of molecular phylogenies. Zhou et al. (2018) described G. zhoui from a central area of Hainan Island, but the exact locality and its molecular sequence were not provided. Subsequently, Liang et al. (2018) constructed a well-supported mito-nuclear phylogenetic tree indicating that G. zhoui was the sister species to G. hainanensis + G. lichtenfelderi, which collectively, were the sister lineage to G. bawanglingensis. This result contradicted previous classifications that placed G. bawanglingensis within the G. luii group and transferred this species to the G. lichtenfelderi group. Zhou et al. (2019) described the fourth Goniurosaurus species from Hainan Island, namely G. sinensis based on its morphological and genetic differences from G. hainanensis. However, the exact locality was withheld due to conservation concerns and the molecular sequence data were not placed in a public database. Shortly afterwards, Zhu et al. (2020b) described a species similar in appearance to G. sinensis, namely G. kwanghua. They share similar morphological diagnoses and their distribution data were also withheld for the same reason. However, sequences on the Genbank were available. Cai et al. (2022) synonymized G. kwanghua with G. sinensis but provided no justification for doing so.

Thus far, seven nominal species have been described in the G. lichtenfelderi group, of which five are currently recognized as valid species, including, G. lichtenfelderi (Mocquard, 1897), G. hainanensis Barbour, 1908, G. bawanglingensis Grismer, Shi, Orlov & Ananjeva, 2002, G. zhoui Zhou, Wang, Chen & Liang, 2018, and G. sinensis Zhou, Peng, Hou & Yuan, 2019. These species are distributed from northern Vietnam including islands of the Beibu Gulf (= Gulf of Tonkin), through the China-Vietnam border, to southern Guangxi, Hainan Island, and adjacent islands, China. Among them, four species are only known to occur on Hainan Island, China, excluding G. lichtenfelderi.

Although these studies have advanced our understanding of the evolutionary relationships and potential species diversity within the G. lichtenfelderi group, the taxonomic uncertainties regarding G. lichtenfelderi, G. hainanensis, G. sinensis and its junior synonym G. kwanghua remain unresolved. This is because previous taxonomic work was based on limited and discontinuous sampling and lacked comparisons to topotypic material. Molecular and morphological data were obtained selectively from isolated localities to analyze lineage structures and relationships, leading to erroneous conclusions based on incomplete evidence. Furthermore, such selective sampling resulted in an overreliance on genetic differentiation and molecular phylogenetic trees, with morphology serving as supplementary evidence, and weakened by the use of limited specimens, ultimately contributing to biased and misleading conclusions. In addition, the undisclosed type specimen information and the opacity of type localities have further impeded the taxonomic progress.

To address these gaps, we conducted an integrative taxonomic revision of the G. lichtenfelderi group using the most extensive molecular dataset assembled to date, including topotypic samples and genome-wide single nucleotide polymorphism (SNP) data. Using this approach, we aim to explore and clarify the systematics of the group and propose taxonomic changes that will better reflect its evolutionary history and maintain monophyly.

Materials and Methods

Morphological data and analyses

We examined 97 preserved specimens of Goniurosaurus, including 25 specimens of G. bawanglingensis, four of G. sinensis (= G. kwanghua; = G. hainanensis sensu stricto in results), 38 of G. hainanensis from the east side of the island (= G. cf. lichtenfelderi in results) and 13 of G. hainanensis (= G. hainanensis sensu stricto in results) from the west side of the island, and 17 of G. zhoui. Due to the poor preservation of some specimens, only 23 of G. bawanglingensis, 24 of G. hainanensis from the east side of the island, 13 of western clade G. hainanensis, and 18 of G. zhoui were included in the subsequent statistical analyses. The specimens examined in this study are deposited in ECNU East China Normal University; HNNU Hainan Normal University; LSUHC La Sierra University Herpetological Collection; MCZ Museum of Comparative Zoology, Harvard University; MVZ Museum of Vertebrate Zoology, University of California, Berkeley; SYS Sun Yat-sen University.

The morphological characters examined followed Grismer et al. (2002), Zhou et al. (2018), Zhou et al. (2019), and Zhu et al. (2020b). External measurements were taken with digital calipers (Neiko 01407A Stainless Steel 6-Inch Digital Caliper, USA) to the nearest 0.1 mm on the right side of each individual by Shuo Qi. Abbreviations of morphological characters are as follows: SVL snout-vent length, from tip of snout to vent; AG axilla to groin length, from posterior edge of forelimb insertion to anterior edge of hind limb insertion; ID internarial distance, distance between nares; HL head length, from the tip of snout to posterior edge of occiput; HW maximum head width; IO interorbital distance, distance between posteriormost points of eyes; AD diameter of auditory meatus; SL snout to eye distance, measured from tip of snout to anteriormost point of eye; ED greatest diameter of eye; FLL forelimb length, from axilla to the tip of the fourth finger; HLL hind limb length, from groin to the tip of the fourth toe. SPL supralabials; IFL infralabials; N nasal scales surrounding nare; IN internasals; PostIN granular scales bordering the internasals;PM postmentals; GP gular scales bordering postmentals; CIL eyelid fringe scales or ciliaria; PO preorbital scales, number of scales in a line from the posterior margin of external naris to the anterior margin of the bony orbit; GST granular scales surrounding dorsal tubercles; PTL paravertebral tubercles between limb insertions; DTR longitudinal dorsal tubercle rows at midbody; MB scales around midbody; PP precloacal pores; PAT postcloacal tubercles. Bilateral scale counts are given as left/right.

All statistical analyses were conducted using R version 4.4.2 (R Core Team 2024). A multiple factor analysis (MFA) using the R package FactorMineR (Husson et al. 2017) and visualized using the Factoextra package (Kassambara and Mundt 2017) was used to compare differences and similarities in morphospace of individuals from the G. lichtenfelderi group. The MFA used a concatenated data set comprised of 12 size-corrected morphometric characters (SVL, AG, ID, HL, HW, IO, AD, SL, ED, EE, FLL, HLL) and 15 meristic characters (SPL, IFL, N, IN, PostN, PM, GP, CIL, PO, GST, PTL, DTR, MB, PP, PAT). To remove potential effects of allometry in the morphometric characters (see Chan and Grismer 2022), measurements were size-corrected using the following equation: Xadj = log(X)-β[log(SVL)-log(SVLmean)], where Xadj = adjusted value; X = measured value; β = unstandardized regression coefficient for each population; and SVLmean = overall average SVL of all populations (Thorpe 1975, 1983; Turan 1999; Lleonart et al. 2000). MFA is a global, unsupervised, multivariate analysis that incorporates qualitative and quantitative data (Pagès 2015) simultaneously, making it possible to include different data types in a nearly total morphological evidence environment. All data types are standardized, preventing one data type from overleveraging the output. The MFA dataset is in Table S1.

A PERMANOVA analysis from the vegan package 2.5–3 in R (Oksanen et al. 2020) was used to determine if the centroid locations and group clusters of each species/population from the MFA were statistically different from one another (Skalski et al. 2018) based on the load scores of dimensions 1–5. Using load scores as opposed to raw data, which are normally used, allows for the incorporation of the categorical characters which cannot be run untransformed in a PERMANOVA. All load scores for the PCAs, however, were used. The analysis calculates a Euclidean (dis)similarity matrix using 50,000 permutations. A pairwise post hoc test calculates the differences between the populations, generating a Bonferroni-adjusted p value and a pseudo-F ratio (F statistic). A p < 0.05 is considered significant and larger F statistics indicate more pronounced group separation. A rejection of the null hypothesis (i.e., centroid positions and the spread of the data points [i.e., clusters] are no different from random) signifies a statistically significant difference between species/populations.

One-way analysis of variance (ANOVA) was performed on a dataset coded for species to examine statistically significant mean differences (p < 0.05) among characters using car R package. Character means showing significant differences were subjected to a Tukey HSD test to determine which pairs of species differed significantly for those specific characters. Violin plots and the inserted/independent boxplots were generated to visualize the range, frequency, mean, 50% quartile, and degree of differences between the dependent variables for datasets with statistically significant mean differences using ggplot2 R package.

DNA sampling, extraction, and sequencing

Mitochondrial and nuclear DNA. Seventy-eight newly collected samples of Goniurosaurus geckos were used in this study, including 53 from the G. lichtenfelderi group, 18 from the G. luii group, and 7 from the G. yingdeensis group. All Goniurosaurus specimens were collected during field surveys from 2014 to 2023. Prior to February 5th, 2021—the date on which the newly revised List of National Key Protected Wild Animals in China (National Forestry and Grassland Administration and Ministry of Agriculture and Rural Affairs of the People’s Republic of China 2021) came into effect, specimens were retained as vouchers, and tissues for DNA extraction were mainly taken from muscle or tail tips. After this date, specimens were no longer retained but were released at the site of capture following non-lethal sampling, with either oral swabs or tail tip tissue collected for molecular analyses. This protocol was implemented to ensure full compliance with updated national wildlife protection regulations, which prohibit the long-term removal of protected species from the wild. DNA was extracted from each tissue sample using a standard extraction kit (Tiangen Biotech, Beijing, China). Two mitochondrial genomic fragments with 495 base pairs (bp) of 16S ribosomal RNA (16S) and 396 bp of cytochrome b (cyt b) and two nuclear genes with 369 base pairs (bp) of C-mos and 990 bp of Rag1 were amplified in this study. Primers used in this study are listed in Table 1. PCR amplifications were performed in a 20 μL reaction volume with the following cycling conditions: an initial denaturing step at 94°C for 5 min, 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, and a final extension step of 72°C for 10 min (Liang et al. 2018). PCR products were purified with spin columns and then sequenced with forward primers using BigDye Terminator Cycle Sequencing Kit as per the guidelines on an ABI Prism 3730 automated DNA sequencer by Wuhan Tianyi Huiyuan Bioscience & Technology Inc.

For the Vietnamese samples, DNA was extracted and amplified at Hanoi University of Science (HUS), Hanoi, Vietnam, following the protocol described in Ngo et al. (2021).

A total of 561 sequences were used in the phylogenetic analyses, including 543 sequences of Goniurosaurus species and 18 outgroup sequences (see Table S2 for detail). Among them, 280 newly sequenced data have been deposited in GenBase (https://ngdc.cncb.ac.cn/genbase), and all other sequences were downloaded from GenBank (https://www.ncbi.nlm.nih.gov/genbank).

Table 1.

Primers used in this study.

Locus and description Primer name Primer sequence (5’-3’) Sources
16S r16S-5L GGTMMYGCCTGCCCAGTG Jonniaux and Kumazawa (2008)
16sbr-H CCGGTCTGAACTCAGATCACGT Jonniaux and Kumazawa (2008)
cyt b L14731 TGGTCTGAAAAACCATTGTTG Honda et al. (2014)
H15149m GCMCCTCAGAAKGATATTTGYCCTCA Kocher et al. (1989)
C-mos FU-F TTTGGTTCKGTCTACAAGGCTAC Gamble et al. (2008)
FU-R AGGGAACATCCAAAGTCTCCAAT Gamble et al. (2008)
Rag1 R13 TCTGAATGGAAATTCAAGCTGTT Groth and Barrowclough (1999)
R18 GATGCTGCCTCGGTCGGCCACCTTT Groth and Barrowclough (1999)

ddRAD library preparation and sequencing. To further evaluate putative species boundaries and clades recovered in the Sanger sequencing analyses in a more genomically comprehensive context, a small subset of samples was selected for double-digest restriction site-associated DNA sequencing (ddRAD-seq). Genomic DNA was extracted from 76 individuals of the G. lichtenfelderi group, as well as an outgroup sample of G. yingdeensis, using a universal DNA extraction kit (GenStar, Beijing, China), following the manufacturer’s instructions. DNA quality and concentration were assessed by agarose gel electrophoresis and a Qubit fluorometer (Thermo Fisher Scientific, USA). Library construction and sequencing were conducted by Guangzhou Jierui Bioscience & Technology Inc. Briefly, 200 ng of genomic DNA from each sample was digested with EcoRI and PstI (New England Biolabs, USA) and ligated to adapters containing unique barcodes and compatible overhangs using T4 DNA ligase (New England Biolabs). Barcoded samples were pooled in equal volumes, and fragments in the 350–550 bp range were isolated through agarose gel electrophoresis and purified (Omega Bio-tek, Nocross, USA). The pooled library was PCR-amplified and sequenced on an Illumina NovaSeq platform using 150 bp paired-end reads.

ddRAD-seq bioinformatics and SNP calling. Raw reads were demultiplexed and quality-filtered with the process_radtags module in Stacks v2.6 (Catchen et al. 2013; Rochette et al. 2019), discarding low-quality reads and adapter sequences. Reads were truncated to 135 bp and had to be at least 140 bp long to be retained. De novo assembly was performed using ustacks (minimum coverage m = 2, maximum mismatches per locus M = 10), and loci were merged across individuals with cstacks (number of mismatches allowed = 10). Each sample was then aligned against the catalog using sstacks. The tsv2bam and gstacks modules carried out genotype calling under a maximum-likelihood framework, after which populations filtered out low-quality and potentially linked SNPs. Following these steps, a total of 5301 high-quality SNPs, spanning 5416 RAD loci were retained for downstream population structure analyses and phylogenetic inference of the G. lichtenfelderi group.

Phylogenetic and population genetic analyses

Sequence-based phylogenetic inference. DNA sequences were aligned using the MAFFT algorithm (Katoh and Standley 2013) and trimmed with gaps partially deleted in Gblocks (Talavera and Castresana 2007). We generated up to 2242 nucleotides of aligned sequence data including partial sequences for two mitochondrial genes (16S, 487 bp; cyt b, 396 bp) and two nuclear genes (C-mos, 369 bp; Rag1, 990 bp). For Bayesian phylogenetic inference in MrBayes 3.2.4 (Ronquist et al. 2012), PartitionFinder v2.1 (Lanfear et al. 2017) was used to determine the best-fit partitioning scheme and nucleotide substitution models. Two independent MCMC runs were conducted with 10,000,000 generations each, sampling every 1000 generations and discarding the first 25% as burn-in, achieving a potential scale reduction factor (PSRF) < 0.005. Maximum likelihood analysis was performed in IQ-TREE v2.0 (Minh et al. 2020) using the BIC criterion implemented in ModelFinder to select the best substitution model (Kalyaanamoorthy et al. 2017). A bootstrap consensus tree was inferred from 1000 replicates. Node support was evaluated using Bayesian posterior probabilities (BPP), ultrafast bootstrap (UFB) values, and SH-aLRT (approximate likelihood ratio test) values. Nodes with BPP ≥ 0.95, UFB ≥ 95, and SH-aLRT ≥ 80 were considered strongly supported.

To further examine genetic divergence, uncorrected pairwise sequence distances for the cyt b gene were calculated in MEGA 6 (Tamura et al. 2013) using the Kimura 2-parameter (K2P) model. Mean genetic distances were computed both within and between species. Haplotype networks were constructed using PopART v1.7 (Leigh and Bryant 2015) with the Median Joining Network algorithm. All phylogenetic trees were visualized and edited in TVBOT v2.6.1 (Xie et al. 2023).

SNP-based Structure and ML Tree Inference. We used a model-based clustering approach implemented in STRUCTURE v2.3.4 (Pritchard et al. 2000). Analyses were conducted under an admixture model with correlated allele frequencies. The SNP dataset, formatted for STRUCTURE, was analyzed across a range of K values to determine the most likely number of genetic clusters. For each K, we performed multiple independent runs with a burn-in of 100,000 iterations followed by 1,000,000 MCMC iterations. Results were averaged across replicates, and the optimal K was identified using the ΔK method of Evanno et al. (2005), based on the rate of change in log-likelihood values [LnP(D)]. Individuals were then assigned to clusters according to their estimated ancestry proportions. We also verified the consistency of clustering patterns using alternative methods, although STRUCTURE served as the primary tool for inference. These results revealed clear genetic subdivisions and admixture patterns within the G. lichtenfelderi group.

To reconstruct phylogenetic relationships, we reconstructed a maximum likelihood (ML) tree based on the SNP dataset. A concatenated alignment including one SNP per RAD locus was generated in PHYLIP format using Stacks output. Tree inference was performed in IQ-TREE v2.0, which selected the best-fit substitution model via ModelFinder. Branch support was assessed with 1000 ultrafast bootstrap replicates. The resulting tree provided a well-resolved phylogeny of the G. lichtenfelderi group. An outgroup from a congeneric species outside the group was used for rooting, allowing interpretation of evolutionary direction. All analyses were conducted with default parameters unless specified otherwise, and the final tree was visualized using TVBOT v2.6.1.

Dating analyses. We estimated divergence times using PAML v4.9j (Yang 2007) based on a concatenated dataset of four genetic markers. A relaxed molecular clock model (clock = 2) was applied to account for rate variation among lineages. The F84 model was used to model nucleotide substitution rates, as determined by prior model testing. The approximate likelihood method (usedata = 2) was employed to improve computational efficiency for large datasets. Among-site rate heterogeneity was modeled using a gamma distribution with a shape parameter (alpha = 0.5) and five discrete categories (ncatG = 5).

Priors were set following standard practice: the mean substitution rate prior (rgene_gamma) was set with α = 2 and β = 20 (corresponding to 0.1 substitutions/site/100 million years ago, Mya), and the rate variance across branches prior (sigma2_gamma) was defined as α = 1 and β = 10. MCMC chains were run for 6,000,000 iterations, sampling every 10 iterations, with a burn-in of 1,000,000, resulting in 500,000 samples used for posterior estimation. Convergence was verified using standard diagnostics.

As there are no reliable fossil records for Goniurosaurus, we applied secondary calibrations based on divergence estimates within Eublepharidae (Agarwal et al. 2022). Additionally, three fossil calibrations from Gekkota (Agarwal et al. 2020) were used: Burmese amber fossils for crown Gekkota (offset = 99 Mya); Pygopus hortulanus for the stem of Pygopus (offset = 23 Mya); the divergence between Phelsuma inexpectata and P. ornata (uniform prior: 0.05–5 Mya). We also included the earliest fossil record of Tarentola (offset = 11.6 Mya) as a genus-level constraint. Final divergence estimates are reported as medians with 95% highest posterior density (HPD) intervals in millions of years ago (Mya). Sample information for dating analyses see Table S3.

Results

Phylogenetic relationships

Phylogenetic inference from mitochondrial and nuclear DNA. In Figure 1A, both Bayesian Inference (BI) and Maximum Likelihood (ML) phylogenetic analyses were conducted based on a concatenated dataset comprising two mitochondrial (16S, cyt b) and two nuclear (C-mos, Rag1) gene fragments. These combined analyses consistently recovered the same interspecific relationships within the G. lichtenfelderi group, providing robust support for species delimitation. Both methods strongly supported the monophyly of G. bawanglingensis and G. zhoui, with high nodal support values (BPP = 0.99/1.00; UFB = 99/100; SH-aLRT = 97.8/100), thereby validating their status as distinct evolutionary lineages. In contrast, G. hainanensis is recovered as polyphyletic, forming two distinct clades—eastern and western. Goniurosaurus sinensis was strongly supported but was embedded within the western clade of G. hainanensis (BPP = 1.00; UFB = 98; SH-aLRT = 94.6). The sister relationship between G. lichtenfelderi and the eastern clade of G. hainanensis received weak support (BPP = 0.61; UFB = 79; SH-aLRT = 68.9), indicating that this relationship should be interpreted cautiously. Although G. sinensis is strongly supported it is embedded within the western clade of G. hainanensis (BPP = 100), and together they form a monophyletic lineage with G. lichtenfelderi and the eastern clade of G. hainanensis. Based on mitochondrial cyt b genetic distances (Table 2), G. bawanglingensis and G. zhoui exhibit substantial genetic divergence from members of the G. lichtenfelderi species group. The mean interspecific genetic distances were 17.52–19.81% for G. bawanglingensis and 14.24–16.25% for G. zhoui, respectively, supporting their recognition as distinct evolutionary lineages. The mean genetic distance between G. lichtenfelderi and G. sinensis was 7.20%, while G. lichtenfelderi showed a distance of 7.69% to the western clade of G. hainanensis and 6.13% to the eastern clade. In contrast, the western clade of G. hainanensis was genetically very close to G. sinensis, with a mean distance of only 2.45%, whereas its distance to the eastern clade of G. hainanensis was 7.69%.

Figure 1. 

A The Bayesian inference (BI) phylogenetic tree and the Maximum likelihood (ML) phylogenetic tree of family Eublepharidae and Goniurosaurus lichtenfelderi group, inferred by two mitochondrial gene fragments (16S and cyt b) and two nuclear gene fragments (C-mos and Rag1). B The haplotype network structure, based on cyt b gene, the black circles represent missing haplotypes in the mutation process. More details of the abbreviations of locations are included in Table S2.

Table 2.

Sample size and mean intra- and interspecific genetic distances of Goniurosaurus species based on mitochondrial cyt b sequences.

Species Sample size 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25
1 G. kuroiwae 2 1.30
2 G. nebulozonatus 2 6.77 0.00
3 G. orientalis 2 6.25 8.07 0.00
4 G. sengokui 2 5.86 6.77 5.99 0.00
5 G. splendens 2 13.93 16.93 15.10 13.80 0.52
6 G. toyamai 2 5.21 7.16 7.42 5.34 14.71 0.26
7 G. yamashinae 1 6.51 5.99 6.77 5.47 14.84 6.64 n/a
8 G. bawanglingensis 14 24.00 23.64 25.24 23.87 27.16 23.10 23.34 3.29
9 G. hainanensis 14 23.21 24.83 24.13 24.39 24.78 23.21 23.08 16.96 2.43
10 G. lichtenfelderi 8 22.71 23.52 24.53 23.59 26.07 22.58 23.02 15.88 6.87 2.19
11 G. cf. lichtenfelderi 18 22.82 22.88 24.25 23.60 26.92 22.30 23.08 15.31 7.15 5.32 2.39
12 G. zhoui 16 23.31 23.76 23.70 24.84 24.25 24.25 23.34 16.69 13.67 13.74 14.24 1.68
13 G. araneus 5 18.49 18.49 19.79 19.53 21.07 18.36 20.31 20.06 21.01 20.26 20.77 18.66 0.21
14 G. catbaensis 2 19.27 19.79 20.31 20.83 22.01 19.40 21.09 20.15 19.92 21.02 20.21 18.51 12.08 0.00
15 G. chengzheng 2 18.88 19.14 19.66 18.88 20.83 18.49 17.84 19.61 19.96 19.58 20.21 17.76 9.87 11.85 0.26
16 G. gezhi 4 19.34 19.86 19.86 19.08 20.25 18.42 19.60 20.84 20.49 20.59 20.54 19.21 10.07 12.04 6.18 0.13
17 G. huuliensis 4 20.96 20.70 21.48 20.83 22.85 19.27 20.96 18.70 21.51 21.08 20.74 20.41 11.50 11.26 10.22 11.46 0.39
18 G. kwangsiensis 4 18.36 19.14 20.18 20.18 20.83 18.95 20.31 18.79 22.04 20.55 20.67 19.04 11.04 14.06 12.37 12.57 10.61 0.87
19 G. liboensis 5 20.31 20.36 21.82 21.25 22.32 20.08 20.73 19.11 21.15 20.26 20.05 18.86 11.93 15.26 11.17 12.67 10.22 7.50 1.51
20 G. luii 8 18.68 19.53 19.50 19.56 22.14 17.90 19.82 18.17 21.69 21.08 20.41 20.12 10.68 12.14 10.12 10.06 3.24 9.47 9.99 0.90
21 G. gollum 3 22.53 22.40 23.70 23.70 23.44 22.66 22.14 22.08 21.30 22.42 21.78 22.44 20.42 21.61 21.48 21.42 21.29 19.01 19.27 20.67 0.00
22 G. varius 7 23.75 22.51 23.92 24.70 26.19 24.18 24.96 21.51 23.08 22.42 22.38 20.98 18.67 20.09 20.11 21.05 21.29 19.87 20.59 20.48 14.81 1.84
23 G. wangshu 6 23.09 22.79 23.91 24.00 22.18 23.13 22.44 21.78 21.31 22.22 21.26 23.04 19.59 21.74 22.40 20.94 22.46 21.40 22.25 21.45 10.89 14.27 4.39
24 G. yingdeensis 10 23.26 21.30 24.48 23.65 25.52 23.13 23.65 21.65 21.65 21.64 21.65 21.59 18.93 20.44 19.53 19.41 20.63 18.98 20.70 19.32 13.20 9.75 13.13 0.65
25 G. zhelongi 10 22.84 21.35 23.18 23.44 24.45 23.83 23.18 19.99 20.19 21.07 20.05 19.20 16.54 17.79 17.34 19.10 20.49 18.41 19.40 19.58 11.61 7.28 12.93 8.19 0.28

Haplotype network analysis based on mitochondrial sequence (cyt b) revealed a clear pattern of genetic differentiation within the G. lichtenfelderi group (Fig. 1B). Goniurosaurus bawanglingensis and G. zhoui each formed distinct and compact haplotype clusters, consistent with their monophyly recovered in the phylogenetic trees, thereby supporting their validity as independent species. In contrast, the haplotypes of G. hainanensis, G. sinensis, and G. lichtenfelderi showed complex relationships. The western clade of G. hainanensis shared highly similar and closely connected haplotypes with G. sinensis, without clear separation, indicating minimal genetic differentiation between them. The eastern clade of G. hainanensis exhibited haplotypes that were very similar to those of G. lichtenfelderi; however, no intermixing was observed, with G. lichtenfelderi maintaining a distinct and well-separated cluster.

Taken together, the phylogenetic results suggest that the taxon currently referred to as G. hainanensis on Hainan Island may comprise two deeply divergent evolutionary lineages, but this inference requires further validation with higher-resolution genomic data.

Phylogenetic inference from SNP data. The maximum likelihood (ML) tree inferred from concatenated SNP data (one SNP per locus) recovered five distinct clades, each corresponding to putatively independent lineages (Fig. 2A). The outgroup sample (G. yingdeensis) was included in the ddRAD-seq dataset for rooting purposes but is not displayed in the phylogenetic trees presented in this study. The phylogeny exhibited strong support at nearly all nodes (black dots: bootstrap >90%), and clearly resolved the relationships among geographically isolated populations. Individuals from the same locality or morphologically defined species formed cohesive genetic clusters, such as G. bawanglingensis, G. zhoui, G. lichtenfelderi, and the eastern (G. cf. lichtenfelderi) and western clades (G. hainanensis sensu stricto) of G. hainanensis. Compared to traditional sequence-based markers, the SNP data provided higher resolution, revealing subtle genetic divergences even between geographically proximate populations. The SNP phylogeny also supports the paraphyly of G. hainanensis on Hainan Island, consistent with results from mitochondrial and nuclear genes.

Figure 2. 

Genetic relationships and population structure of the Goniurosaurus lichtenfelderi group inferred from genome-wide SNPs. A Phylogenetic tree of the G. lichtenfelderi group based on SNP data derived from double-digest restriction-site associated DNA sequencing (ddRAD-seq), bootstrap supports (BS) less than 70 were left out; B Estimation of the optimal number of genetic clusters (K) based on ΔK values from STRUCTURE analysis; C Genetic structure of the G. lichtenfelderi group inferred from STRUCTURE analysis at the K value from 2 to 5. Abbreviations of localities: DDZ (Dongzhong town, Guangxi); RT (Rongtang village, Hainan); DL (Diaoluoshan, Hainan); QX (Qixianling, Hainan); FT (Fantong village, Hainan); MY (Maoyang town, Hainan); FH (Fenghuangling, Hainan); BWL (Bawangling, Hainan); JF (Tianchi, Jianfengling, Hainan); ZF (Main Peak, Jianfengling, Hainan); EX (Exianling, Hainan); NK (Nankai town, Hainan); WX (Wangxia town, Hainan).

Model-based clustering implemented in STRUCTURE, evaluated across K = 2–10, iden­ti­fied K = 3 as the optimal number of genetic clusters according to the ΔK method (Fig. 2B). Under this optimal clustering scheme (K = 3), the individuals of the G. lichtenfelderi group were assigned to three genetic clusters that only partially correspond to phylogeny. The first cluster (red) includes both the eastern and western clades of G. hainanensis along with continental populations of G. lichtenfelderi, reflecting genetic admixture or shared ancestry signals at the population level, rather than distinct population structuring. The second cluster (yellow) corresponds primarily to G. bawanglingensis, and the third cluster (blue) to G. zhoui. However, the admixture plot reveals signs of recent gene flow between G. bawanglingensis and G. zhoui, particularly in populations from locality Exianling (EX). Individuals from this site exhibit varying proportions of ancestry from both genetic clusters, indicating potential hybridization or recent introgression. The uneven admixture proportions among individuals from the same site further suggest that this genetic mixing may be ongoing and not the result of ancient shared ancestry.

Divergence dating. The MCMCtree analysis (Fig. 3) based on concatenated mitochondrial (16S, cyt b) and nuclear (C-mos, Rag1) genes. Effective sample sizes (ESS) for all parameters exceeded 200, indicating good mixing and convergence of the analysis.

Divergence time estimates place the most recent common ancestor (MRCA) of Eublepharidae at 82.9 Mya (95% HPD: 93–73 Mya). The divergence between Goniurosaurus and the clade comprising Eublepharis and two African genera occurred at 59.4 Mya (95% HPD: 67–53 Mya). Within Goniurosaurus, G. kuroiwae group diverged around 43.1 Ma (95% HPD: 53–34 Mya), followed by G. yingdeensis group at 34.2 Mya (95% HPD: 42–26 Mya), and finally, the divergence between the G. lichtenfelderi group and G. luii group occurred at 28.7 Mya (95% HPD: 36–22 Mya). Within the G. lichtenfelderi group, G. bawanglingensis is the earliest diverging lineage, with an estimated divergence time of 14.7 Mya (95% HPD: 20–10 Mya); followed by G. zhoui at 10.9 Mya (95% HPD: 15–7 Ma); Subsequently, two major clades emerged: one comprising G. lichtenfelderi and the eastern clade of G. hainanensis, and the other comprising the western clade of G. hainanensis and G. sinensis, with a divergence time of 5.3 Mya (95% HPD: 8–3 Mya). The divergence between G. lichtenfelderi and the eastern G. hainanensis clade occurred at 3.8 Mya (95% HPD: 6–2 Mya), while the western G. hainanensis clade diverged from G. sinensis much more recently, at 1.1 Mya (95% HPD: 2–0.3 Mya).

Figure 3. 

Divergence time tree of Gekkota, including the family Eublepharidae, inferred using MCMCtree from a combined dataset of two mitochondrial genes (16S and cyt b) and two nuclear genes (C-mos and Rag1). Algyroides fitzingeri (Lacertidae) was used as outgroup. Node calibrations were applied based on fossil and/or secondary calibration points (see Materials and Methods for details).

Statistics for morphometric data. The MFA and subsequent PERMANOVA recovered statistically different morpho-spatial differences among all species pairs except the eastern and western clades of G. hainanensis (Fig. 4; Table 3). Dimension 1 in the MFA accounted for 18.3% of the variation in the data set and loaded most heavily for the meristic data and dimension 2 accounted for an additional 16.9% of the variation. The PERMANOVA analysis indicated that each species’ centroid position is statistically different from others in the morphological space, except that between the eastern and western clades (adjusted p value = 1). However, the ANOVA analyses still indicated that the eastern and western clades differ significantly in head length (HL, p = 0.003), head width (HW, p = 0.019), hind limb length (HLL, p = 0.022), Internarial distance (ID, p = 0.002), and number of postmental scales (PM, p = 0.006) (Table 4). This can also be seen in the violin plots with inserted boxplots for morphometric data and the boxplots with inserted scatter plot for meristic data (Figs 5, 6). These results suggested that the eastern and western clades of G. hainanensis are morphologically different from each other in some characters despite the relatively smaller divergences compared to the G. bawanglingensis and G. zhoui, that is consistent with the conclusion of molecular analyses.

Figure 4. 

A Result of multiple factor analysis (MFA), the clustering of Goniurosaurus bawanglingensis, G. zhoui, G. cf. lichtenfelderi and G. hainanensis along dimensions 1 and 2 from the MFA. B The percent contribution of meristic and size-corrected morphometric characters of the first five dimensions of the MFA.

Figure 5. 

Violin plots with embedded boxplots illustrating the distribution of 12 morphometric characters across Goniurosaurus bawanglingensis, G. zhoui, G. cf. lichtenfelderi and G. hainanensis. Each plot shows the relative variation within and between groups.

Figure 6. 

Boxplots with overlaid scatter plots illustrating the distribution of 15 meristic characters across Goniurosaurus bawanglingensis, G. zhoui, G. cf. lichtenfelderi and G. hainanensis. Each plot shows individual data points along with group medians and interquartile ranges.

Table 3.

PERMANOVA summary statistics base on the MFA. Shaded cells represent species pairs bearing statistically different centroid positions.

Pairs F.Model R2 p.value p.adjusted
cf. lichtenfelderi vs. hainanensis 1.83841479 0.05129732 0.22043559 1
cf. lichtenfelderi vs. bawanglingensis 14.4823355 0.24347288 2.00E-05 0.00012
cf. lichtenfelderi vs. zhoui 8.36439893 0.17294537 0.00053999 0.00323994
hainanensis vs. bawanglingensis 2.98932118 0.08306134 8.00E-05 0.00047999
hainanensis vs. zhoui 1.93953808 0.06478183 0.0049799 0.0298794
bawanglingensis vs. zhoui 16.2723735 0.29440338 2.00E-05 0.00012
Table 4.

Species pairs of Goniurosaurus from Hainan Island bearing statistically different mean values in head length (HL), head width (HW), hind limb length (HLL), internarial distance (ID) and number of post mentals (PM). Numbers are the p values. Shaded cells are species pairs that are not significantly different.

HL bawanglingensis zhoui cf. lichtenfelderi hainanensis
bawanglingensis 2.71e-06 0.00018189
zhoui 2.71e-06 0.00010860
cf. lichtenfelderi 0.00010860 0.00336875
hainanensis 0.00018189 0.00336875
HW bawanglingensis zhoui cf. lichtenfelderi hainanensis
bawanglingensis 3.05e-05 0.01155973 2.27e-06
zhoui 3.05e-05
cf. lichtenfelderi 0.01155973 0.01877897
hainanensis 2.27e-06 0.01877897
HLL bawanglingensis zhoui cf. lichtenfelderi hainanensis
bawanglingensis 1.36e-07 0.000128854 2.92e-08
zhoui 1.36e-07
cf. lichtenfelderi 0.000128854 0.02222431
hainanensis 2.92e-08 0.02222431
ID bawanglingensis zhoui cf. lichtenfelderi hainanensis
bawanglingensis
zhoui 7.22e-05
cf. lichtenfelderi 7.22e-05 0.00187905
hainanensis 0.00187905
PM bawanglingensis zhoui cf. lichtenfelderi hainanensis
bawanglingensis 0.02819262 6.74e-07
zhoui 0.02819262
cf. lichtenfelderi 6.74e-07 0.00621731
hainanensis 0.00621731

Lineage delimitation within the Goniurosaurus lichtenfelderi group

The results presented here provide a robust genetic framework for understanding species boundaries within the G. lichtenfelderi group. Both sequence- and SNP-based trees robustly support the distinctiveness of G. bawanglingensis and G. zhoui as independent evolutionary lineages. However, G. hainanensis is consistently recovered as polyphyletic, comprising two deeply divergent clades on Hainan Island. The western clade, which includes samples from the type locality Wuzhishan, clusters closely with G. sinensis in both sequence- and SNP-based phylogenies, with minimal genetic distance and recent divergence time estimates. Given this strong genetic continuity and the historical context of the type locality, we propose to treat G. sinensis as a junior synonym of G. hainanensis.

In contrast, the eastern clade of G. hainanensis forms a distinct lineage that is genetically closer to continental populations of G. lichtenfelderi than to its western counterpart. Moderate levels of genetic divergence exist between the eastern clade and G. lichtenfelderi, comparable to those observed between other recognized species within the genus (e.g., G. chengzheng vs. G. gezhi; G. luii vs. G. huuliensis). However, due to the lack of comprehensive morphological data for continental G. lichtenfelderi collected by the same observer and the absence of high-coverage genomic evidence to further evaluate the depth and consistency of divergence, we restrict the distribution of G. lichtenfelderi sensu stricto to the Asian mainland and tentatively treat the Hainan Island lineage as G. cf. lichtenfelderi. Future studies incorporating extensive morphological datasets and genome-wide data will be essential to determine whether this lineage warrants formal taxonomic recognition.

Systematics

Family Eublepharidae Boulenger, 1883

Genus Goniurosaurus Barbour, 1908

Goniurosaurus lichtenfelderi group

Morphological diagnosis.

This species group can be differentiated from the other species groups by the combination of the following characters: (1) No significant sexual dimorphism in body size, SVL 73.3–113.5 mm; (2) body and limbs robust; FLL/SVL ratio 0.29–0.31, HLL/SVL ratio 0.41–0.44; (3) 23–46 precloacal pores in males present, form a continuous transverse series extending onto the femora; precloacal pores in females usually absent, expect in a few cases of G. lichtenfelderi; (4) base of claws sheathed by four scales, two lateral scales of claw large, long, and curved; and (5) enlarged row of supraorbital tubercles distinct.

Distribution.

The species of G. lichtenfelderi group are distributed on Hainan Island, in the southwestern region of Guangxi Zhuang Autonomous Region, China, and in northeastern Vietnam. The westernmost record is located in Ba Vi District, west of the Red River, Vietnam (Fig. 7). See species accounts for detailed distribution of each species.

Figure 7. 

Geographic distribution of accepted taxa of the Goniurosaurus lichtenfelderi group. A Prior to the present taxonomic revision; B Following the revised delimitation proposed in this study; C Distributional separation of G. hainanensis and G. cf. lichtenfelderi on Hainan Island.

Species accounts

Goniurosaurus bawanglingensis Grismer, Shi, Orlov & Ananjeva, 2002

Figures 8, 9

Chresonymy.

Eublepharis maculariusHuang (1964) Jiangbian village, Dongfang County (now Dongfang City) (Chinese description with B/W photo).

Chinese name.

霸王岭睑虎 (bà wáng lǐng jiǎn hǔ).

English names.

Bawangling leopard gecko, Bawangling tiger gecko.

Vietnamese name.

Thach sung mi ba wang ling.

Figure 8. 

A Juvenile Goniurosaurus bawanglingensis from Jianfengling NR, photo by Yong-Heng Zhu; B adult Goniurosaurus bawanglingensis from Jianfengling NR, photo by Shuo Qi; C adult Goniurosaurus bawanglingensis from Bawangling NR, photo by Shuo Qi; DEublepharis macularius”, from Hainan Island, cited from Huang (1964).

Holotype.

MVZ 230973, adult male, collected from 5.6 km northeast of the town of Bawangling, Hainan Province, People’s Republic of China, within the Hainan Bawangling National Nature Reserve; collected by L. Lee Grismer on 23 July 2000.

Paratypes.

Ten paratypes in total, four adult females (R9907001, R9907003–04, MVZ 230975) and two adult males (MVZ 230974, 230977) collected from same locality as the holotype; one adult male (MVZ 230978) and one juvenile female (R9907002) from 8–9 km northeast of the town of Bawangling; one adult male (MVZ 230976) from 9.0–9.5 km northeast of the town of Bawangling; and one hatchling (R9907005) from 19 km northeast of the town of Bawangling.

Specimens examined.

15 ♂♂, 10 ♀♀, see Appendix 1 for detail.

Diagnosis.

Based on the previous description (Grismer et al. 2002; Shi et al. 2011) and examined specimens in this study: (1) SVL 83.6–100.1 mm in adult males, 80.0–94.6 mm in adult females; (2) external nares bordered by 7–9 nasal scales; (3) internasal single; (4) supralabials 7–11; (5) infralabials 7–9; (6) preorbital scales 14–19; (7) supraorbital region with a row of slightly enlarged tubercles; (8) eyelid fringe scales 51–67; (9) scales around midbody 85–133; (10) longitudinal dorsal tubercle rows at midbody 20–25; (11) paravertebral tubercles between limb insertions 23–32; (12) axillary pockets deep; (13) presence of 36–46 precloacal pores in males form a continuous transverse series extending onto the femora, and absent in females; (14) dorsal ground color of head yellow-brown, body and limbs dark yellow-brown to dark brown in juveniles, without blotches; dorsal ground color of head, body and limbs brownish-yellow in adults, with small irregularly shaped dark brown blotches; (15) presence of five transverse bands, including one nuchal loop, three body bands and one caudal constriction band, orange-yellow to brownish-yellow with black brown anterior and posterior borders, transverse bands usually with dark brown spots in mature individuals; (16) nuchal loop rounded; (17) iris reddish-orange to dark reddish-brown.

Distribution.

Goniurosaurus bawanglingensis is an endemic species on Hainan Island, which is currently known from Changjiang Li Autonomous County (National Park of Hainan Tropical Rainforest, Bawangling Area, formerly Bawangling National Natural Reserve; Baomeiling Provincial Natural Reserve), Ledong Li Autonomous County (National Park of Hainan Tropical Rainforest, Jianfengling Area, formerly Jianfengling National Natural Reserve), Danzhou City (Nanfeng town), and Dongfang City (Jiangbian village), Hainan Province, China, at elevations of 400–750 m (Huang 1964; Grismer et al. 2002; this study; Fig. 7A, B).

Remarks.

Huang (1964) recorded Eublepharis macularius based on two specimens from Hainan Island. However, this is undoubtedly a misidentification of a member of the genus Goniurosaurus as noted by Grismer (1988) who noted major differences in precloacal pore count, implying it was an undescribed species. One of the specimens was collected from Jiangbian village, Dongfang County (now Dongfang City) with a description and a B/W photo; another male specimen was collected from Nanxi Forestry Farm, Mt. Diaoluo without more detailed information. The specimen that was collected from Jiangbian village should be reidentified as G. bawanglingensis based on the B/W photo (Fig. 9D), morphological description and locality. It is not possible to re-identify the other specimen from Mt. Diaoluo.

Figure 9. 

The holotype of Goniurosaurus bawanglingensis (MVZ 230973, adult male). A Four views of the head; B dorsal and ventral view of the entire body; C close-up of the cloacal region. Photos by Kai Wang.

Goniurosaurus hainanensis Barbour, 1908

Figures 10 (A1, A2, B1, C1–C3), 11 (A–C), 12

Synonymy.

Goniurosaurus sinensis Zhou, Peng, Hou & Yuan, 2019 syn. nov.

Goniurosaurus kwanghua Zhu & He, 2020

Chinese name.

海南睑虎 (hǎi nán jiǎn hǔ).

English names.

Hainan leopard gecko, Hainan tiger gecko.

Vietnamese name.

Thach sung mi hai nan.

Figure 10. 

Morphological comparison of adult Goniurosaurus sinensis syn. nov., Goniurosaurus hainanensis and Goniurosaurus lichtenfelderi. A1 Holotype of Goniurosaurus sinensis syn. nov. (BL-RBZ-102), cited from Zhou et al. (2019); A2 Goniurosaurus sinensis syn. nov. from Mt. Jianfengling, photo by Tong-Liang Wang; B1 Paratype of Goniurosaurus kwanghua (= Goniurosaurus sinensis syn. nov.) (ECNU-V0059), cited from Zhu et al. (2020b); C1 to C3 Goniurosaurus hainanensis from Hainan Province, China (Wuzhishan City, Wuzhishan City and Sanya City, respectively), photos by Shuo Qi and Yong-Heng Zhu (photo C2); D1 to D3 Goniurosaurus lichtenfelderi from Vietnam, photos by Hai Ngoc Ngo; E1 to E3 Goniurosaurus cf. lichtenfelderi from Hainan Province, China (Haikou City, Wanning City and Lingshui County, respectively), photos by Shuo Qi.

Figure 11. 

Morphological comparison of juvenile Goniurosaurus lichtenfelderi with its three junior synonyms: A Goniurosaurus sinensis syn. nov., cited from Zhou et al. (2019); B Goniurosaurus kwanghua (= Goniurosaurus sinensis syn. nov.), cited from Zhu et al. (2020b); C Goniurosaurus hainanensis (western clade) from Hainan Province, China (Baoting County), photo by Shuo Qi; D Goniurosaurus lichtenfelderi from Fangchenggang City, Guangxi Zhuang Autonomous Region, China, photo by Shuo Qi.

Figure 12. 

The holotype of Goniurosaurus hainanensis (MCZ 7104, unsex juvenile), A Dorsal and ventral view of the entire body; B Three views of the head; C Hand-drawn illustration. A and B by Museum of Comparative Zoology, Harvard University, © President and Fellows of Harvard College; C from Barbour (1909).

Holotype.

A juvenile male, MCZ 7104, collected from Mt. Wuchi (= Mt. Wuzhi), Hainan, China on 16 November 1906, by a Japanese collector (probably Zensaku Katsumata) of Alan Owston.

Specimens examined.

11 ♂♂, 6 ♀♀ from China, see Appendix 1 for detail.

Diagnosis.

Based on the previous description (Grismer 2000; Blair et al. 2009; Zhou et al. 2019; Zhu et al. 2020b) and examined specimens in this study: (1) SVL 69.5–99.7 mm in adult males, 79.7–105.7 mm in adult females; (2) external nares bordered by 7–10 nasal scales; (3) internasal 0–2, mostly single, rarely absent or 2; (4) supralabials 7–11; (5) infralabials 6–11; (6) preorbital scales 15–21; (7) supraorbital region with a row of slightly enlarged tubercles; (8) eyelid fringe scales 47–62; (9) scales around midbody 92–123; (10) longitudinal dorsal tubercle rows at midbody 20–22; (11) paravertebral tubercles between limb insertions 21–27; (12) axillary pockets shallow or deep; (13) presence of 23–31 precloacal pores in males, form a continuous transverse series extending onto the femora; precloacal pores in females absent; (14) dorsal ground color of head, body and limbs dark purple-brown to almost black in juveniles without blotches; dorsal ground color of head, body and limbs purple to dark purple-brown in adults, with or without small irregularly shaped dark brown blotches; (15) presence of four transverse bands, including one nuchal loop, two body bands and one caudal constriction band, light yellow with black brown anterior and posterior borders; (16) nuchal loop mostly rounded posteriorly, rarely protracted; (17) iris orange to dark reddish-brown.

Distribution.

After this taxonomic revision, the distribution of G. hainanensis is restricted to the southern and southwestern regions of Hainan Island, at elevations of 30–800 m (Zhou et al. 2019; Zhu et al. 2020b; this study; Fig. 7A–C). Its northern limit is located in Wuzhishan City, the southern limit in Sanya City, and the western extent reaches to Jianfengling. The eastern boundary remains uncertain, but is tentatively inferred to lie along the northern foothills of the Wuzhishan mountain range. Due to current sampling gaps, it remains unclear whether G. hainanensis and G. cf. lichtenfelderi are sympatric or experience gene flow in this region.

Remarks.

Although the precise type locality of G. hainanensis is not definitively recorded, we infer the northwestern slope of Mt. Wuzhi as the most probable area, considering historical accessibility, transportation, and manpower conditions at the time of collection. Goniurosaurus kwanghua was previously regarded as a junior synonym of G. sinensis (Cai et al. 2022), and our results support this synonymy. Here we additionally synonymize G. sinensis with G. hainanensis, based on integrated genetic evidence and phylogenetic position.

Goniurosaurus lichtenfelderi (Mocquard, 1897)

Figures 10 (D1–D3), 11 (D)

Synonymy.

Eublepharis Lichtenfelderi Mocquard, 1897

Goniurosaurus murphyi Orlov & Darevsky, 1999

Goniurosaurus murhyiKaverkin (2000, in error)

Chinese name.

里氏睑虎 (lǐ shì jiǎn hǔ).

English name.

Lichtenfelder’s gecko.

Vietnamese name.

Thach sung mi lich-ten-phen-do.

Syntypes.

Adult female MNHN-RA 1897.0091 and subadult female MNHN-RA 1897.0092, collected from îles Norway, baie d’Along, golfe du Tonkin, Vietnam; collected by Lichtenfelder (Probably Charles Lichtenfelder).

Specimens examined.

92 ♂♂, 72 ♀♀, 14 juveniles from Vietnam examined by Hai Ngoc Ngo (Ngo et al. 2021).

Diagnosis.

Based on the previous description (Grismer 2000; Nguyen 2011; Ngo et al. 2021): (1) SVL 80.6–113.5 mm in adult males, 81.0–105.5 mm in adult females; (2) external nares bordered by 5–10 nasal scales; (3) internasal 1–5, mostly single or two, rarely 1:2, 2:2 or 2:3; (4) supralabials 7–10; (5) infralabials 6–9; (6) preorbital scales 12–19; (7) supraorbital region with a row of slightly enlarged tubercles; (8) eyelid fringe scales 43–58; (9) scales around midbody 117–131; (10) longitudinal dorsal tubercle rows at midbody 15–22; (11) paravertebral tubercles between limb insertions 22–33; (12) axillary pockets shallow; (13) presence of 24–32 precloacal pores in males, form a continuous transverse series extending onto the femora; precloacal pores in females absent mostly, expect for some individuals from Vietnam with 17−21 indistinct precloacal pores; (14) dorsal ground color of head, body and limbs dark purple-brown to almost black in juveniles without blotches; dorsal ground color of head, body and limbs purple to dark purple-brown in adults, with or without small irregularly shaped dark brown blotches; (15) presence of four transverse bands, including one nuchal loop, two body bands and one caudal constriction band, light yellow with black brown anterior and posterior borders; (16) nuchal loop mostly rounded posteriorly; (17) iris orange to dark reddish-brown.

Distribution.

After this taxonomic revision, G. lichtenfelderi sensu stricto is restricted to the Asian mainland. It is known from Quang Ninh, Bac Giang, Hai Duong, and Hanoi (Ba Vi) in northern Vietnam, as well as from Fangchenggang and Chongzuo in Guangxi Zhuang Autonomous Region, China (Orlov et al. 2020; Ngo et al. 2023; this study).

Remarks.

Orlov et al. (2020) verified the type locality of G. lichtenfelderi as “Ba Mun and Cai Lim Islands, Bai Tu Long National Park, Bai Tu Long Archipelago, Quang Ninh Province” but gave no explanation. Additionally, only a juvenile specimen of G. lichtenfelderi collected from south of the Red River was reported in this study. However, recent extensive field surveys in the area have failed to rediscover the species.

Goniurosaurus cf. lichtenfelderi

Figure 10 (E1–E3)

Specimens examined.

20 ♂♂, 18 ♀♀ from China, see Appendix 1 for detail.

Diagnosis.

Based on this study: (1) SVL 80.1–97.0 mm in adult males, 73.3–97.5 mm in adult females; (2) external nares bordered by 9–11 nasal scales; (3) internasal 0–2, mostly single or two, rarely absent; (4) supralabials 8–11; (5) infralabials 6–9; (6) preorbital scales 14–21; (7) supraorbital region with a row of slightly enlarged tubercles; (8) eyelid fringe scales 50–63; (9) scales around midbody 89–113; (10) longitudinal dorsal tubercle rows at midbody 19–25; (11) paravertebral tubercles between limb insertions 18–24; (12) axillary pockets shallow or deep; (13) presence of 25–31 precloacal pores in males, form a continuous transverse series extending onto the femora; precloacal pores in females absent; (14) dorsal ground color of head, body and limbs dark purple-brown to almost black in juveniles without blotches; dorsal ground color of head, body and limbs purple to dark purple-brown in adults, with or without small irregularly shaped dark brown blotches; (15) presence of four transverse bands, including one nuchal loop, two body bands and one caudal constriction band, light yellow with black brown anterior and posterior borders; (16) nuchal loop mostly rounded posteriorly, rarely protracted; (17) iris orange to dark reddish-brown.

Distribution.

Goniurosaurus cf. lichtenfelderi is only known from Hainan Island, China. Its distribution extends southward from Haikou City, westward to Qiongzhong County, eastward to Wenchang City, and as far south as the southern foothills of the Wuzhishan Mountains, including Qixianling and Diaoluoshan, at elevations of 30–862 m (this study) (Fig. 7A–C).

Goniurosaurus zhoui Zhou, Wang, Chen & Liang, 2018

Figure 13

Chresonymy.

Goniurosaurus bawanglingensisShi et al. (2011) Yinggeling National Natural Reserve.

Chinese name.

周氏睑虎.

English name.

Zhou’s leopard gecko.

Vietnamese name.

Thach sung mi zhou.

Figure 13. 

A Juvenile Goniurosaurus zhoui from Nankai town, photo by Yi-Bo Lin; B adult Goniurosaurus zhoui from Nankai town, photo by Shuo Qi; C and D adult Goniurosaurus zhoui from Wangxia town, photos by Shuo Qi.

Holotype.

BL-RBZ-002, adult male, collected from a central area (ca 220–300 m a.s.l) of Hainan Island, China; exact locality withheld; collected by Run-Bang Zhou on 18 March 2017.

Paratypes.

four paratypes in total, two adult males (BL-RBZ-001, 007) and two adult females (BL-RBZ-003, 008) share same information with holotype.

Specimens examined.

7 ♂♂, 10 ♀♀, see Appendix 1 for detail.

Diagnosis.

Based on the previous description (Zhou et al. 2018) and examined specimens in this study: (1) SVL 92.0–101.5 mm in adult males, 83.7–97.0 mm in adult females; (2) external nares bordered by 6–9 nasal scales; (3) internasal mostly single, rarely two; (4) supralabials 8–10; (5) infralabials 7–9; (6) preorbital scales 14–20; (7) supraorbital region with a row of slightly enlarged tubercles; (8) eyelid fringe scales 49–62; (9) scales around midbody 92–140; (10) longitudinal dorsal tubercle rows at midbody 19–25; (11) paravertebral tubercles between limb insertions 22–32; (12) axillary pockets deep; (13) presence of 36–41 precloacal pores in males form a continuous transverse series extending onto the femora, and absent in females; (14) dorsal ground color of head yellow-brown, body and limbs dark yellow-brown to dark brown in juveniles, without blotches; dorsal ground color of head, body and limbs mauve pink to purple brown in adults, with small irregularly shaped dark brown blotches; (15) presence of five transverse bands, including one nuchal loop, three body bands and one caudal constriction band, yellowish-white to light yellow with black brown anterior and posterior borders, transverse bands usually with dark brown spots in mature individuals; (16) nuchal loop rounded; (17) iris reddish-orange to dark reddish-brown.

Distribution.

Goniurosaurus zhoui is an endemic species on Hainan Island, which is currently known from Baisha Li Autonomous County (Nankai town and National Park of Hainan Tropical Rainforest, Yinggeling Area, formerly Yinggeling National Natural Reserve), Changjiang Li Autonomous County (Wangxia town), Dongfang City (National Park of Hainan Tropical Rainforest, Bawangling Area, formerly Exianling Provincial Natural Reserve) Hainan Province, China, at elevations of 200–390 m (Zhou et al. 2018; this study; Fig. 7A, B).

Remarks.

Zhao and Adler (1993, plate 22C) published a photo identified as G. lichtenfelderi hainanensis. However, it is certain that this specimen cannot be G. lichtenfelderi or G. hainanensis because of differences in coloration and the number of body bands, but instead, it matches the appearance of G. zhoui. Since G. zhoui has not been recorded in the Wuzhishan area, we speculate that the photo’s location might be incorrect (Fig. 14).

Figure 14. 

A questionable photographic record of “Goniurosaurus lichtenfelderi hainanensis” with the original figure legend: “Adult female from west of Wuzhishan (Five Finger Mountain), Hainan Island, Hainan Province, China. Photograph by Richard C. Goris. Note that the tip of the tail has been regenerated in this individual”, cited from Zhao and Adler (1993). However, this individual is morphologically closer to G. zhoui.

Discussion

The geological history of Hainan Island has played a pivotal role in shaping regional biodiversity, yet the timing and process of its separation from the Asian continent remain controversial (Ali et al. 2025). According to our results, the divergence time between the common ancestor of the G. lichtenfelderi group and its closely related groups on the Asian continent occurred around 28.7 Mya (95% HPD: 36–22 Mya), which aligns with the current mainstream view that Hainan Island separated from the Asian continent during the transition between the Eocene and Miocene (Liang et al. 2018; Huang et al. 2024). Furthermore, our results of the distribution patterns and divergence time of Goniurosaurus species on Hainan Island also support the findings of Ali et al. (2025), indicating that the separation of Hainan Island from the Asian continent was not a singular geographical event, but rather a protracted, episodic process of disjunction and reconnection. This also aligns with the perspective of Liang et al. (2018), namely that after Hainan Island separated from the Asian continent, species that evolved independently on the island subsequently dispersed back to the mainland via land bridges. This biogeographic pattern underscores the dual role of Hainan Island as both a sink and a source of novel species diversity in the South China Sea region.

However, due to sampling gaps, Liang et al. (2018) did not include specimens from western Hainan Island, which represent G. hainanensis as redefined in this study. As a result, their discussion regarding the phylogenetic relationship between G. hainanensis and G. lichtenfelderi becomes unreliable. Similarly, the molecular results presented in the original descriptions of G. sinensis and G. kwanghua supported monophyly under the then available taxonomic framework; however, this pattern likely reflects the inclusion of eastern Hainan populations of G. cf. lichtenfelderi identified at the time as G. hainanensis, rather than true G. hainanensis sensu stricto. This also underscores a broader issue: for studies of widespread species, comprehensive sampling and comparisons with topotypic material are particularly critical. Following this taxonomic revision, the number of valid species of the G. lichtenfelderi group is reduced from five to four. Nonetheless, the G. lichtenfelderi populations from the Asian mainland and Hainan Island exhibit distinct morphological differences (i.e., number of scales around midbody, visibility of the preanal pores in females), and their divergence time is comparable to that observed between certain recognized species within the genus (i.e., G. kwangsiensis vs. G. liboensis; G. huuliensis vs. G. luii). While these data suggest evolutionary divergence, we adopt a cautious approach in this study. Considering the variation in measurements between different researchers and the potential influence of historical gene flow on population structure, we refrain from describing a new taxon at this time. Instead, we recognize the possibility of a distinct species, pending further morphological and genomic evidence.

Over the past decades, the diversity of the genus Goniurosaurus has significantly increased with the use of molecular phylogenetics. However, some new species have been described based on only a few specimens from a single locality (Yang and Chan 2015; Zhou et al. 2018, 2019; Zhu et al. 2020a, 2020b, 2021, 2022; Qi et al. 2021a, 2020b). The diagnoses and interspecific genetic differentiation obtained from these specimens often become outdated when sample sizes and geographic coverage are expanded. In particular, several species were established without comparisons to topotypic material, which later proved to lack independent evolutionary origins and should be regarded as taxonomically invalid (Orlov and Darevsky 1999; Yang and Chan 2015). The lack of accessible data for type material has hindered the development of a stable taxonomic framework, thereby impeding taxonomic progress and contravening ethical scientific practices and collegiality. Some researchers withheld the type locality of rare and endangered species when they were described, hoping to avoid poaching and illegal pet trade (Hou et al. 2014; Yang and Chan 2015; Zhou et al. 2019, Zhu et al. 2020b). However, this approach has also sparked some controversy. On the one hand, it can be an effective method to hamper poachers and profiteers. But on the other hand, that does not stop poachers of obtaining distribution information in other ways in this information age. Moreover, the lack of type locality information directly affects and constrains local governments and protection agencies in carrying out targeted conservation measures. At last, unavailable type locality information may cause unnecessary trouble for taxonomic researchers. In conclusion, we fully understand and support why researchers withheld the type locality of the new species if they were actually under direct or potential threats. However, we strongly recommend that molecular data be made available through open-access public databases, as this is essential for transparency and scientific progress.

Our study resolves several long-standing taxonomic issues in the Goniurosaurus lichtenfelderi group and highlights the importance of comprehensive sampling and comparisons with topotypic material for understanding species boundaries. However, several questions remain unanswered and warrant further investigation. For instance, whether G. cf. lichtenfelderi on Hainan Island should be described as an independent species or treated as a geographic population of G. lichtenfelderi. In addition, the current distribution boundaries between G. hainanensis and G. cf. lichtenfelderi on Hainan Island remain unclear, as does whether they occur sympatrically in certain areas and whether a hybrid zone exists between them. Furthermore, the distribution patterns of different species across Hainan Island and adjacent mainland areas require further exploration by integrating phylogenetic, ecological, and biogeographic data. Addressing these questions will not only deepen our understanding of the evolutionary history of the G. lichtenfelderi group but also provide valuable insights for conservation planning and management.

Acknowledgements

We thank Jian Wang, Zhao-Chi Zeng, Hong-Hui Chen, Zhi-Tong Lyu, Shun Ma, Zhi-Fei Ma, Bo Cai, Huan-Qiang Chen, Xu-Ming Qi, and Shi-Li Wang for their assistance with fieldwork. We also thank Yong-Heng Zhu for his help during fieldwork and for providing photo of juvenile Goniurosaurus bawanglingensis; Tong-Liang Wang for assisting in the examination of Goniurosaurus specimens at Hainan Normal University and for providing photos of G. sinensis; Kai Wang for helping to examine the type specimen of G. bawanglingensis and for providing photos; and Yi-Bo Lin for providing photos of juvenile G. zhoui. We thank Stevie Kennedy-Gold and Cynthia Wang-Claypool for their assistance in obtaining photographs of the holotype of Goniurosaurus hainanensis. We are also grateful to the scientific editor and two anonymous reviewers for their valuable suggestions. This work was supported by DFGP Project of Fauna of Guangdong-202115, and the National Animal Collection Resource Center, China.

References

  • Ali JR, Li YX, Fritz U (2025) Biogeography of Hainan Island, southern China, and the falsification of the ‘shifting-landmass’ hypothesis. Palaeogeography, Palaeoclimatology, Palaeoecology 666: 112832. https://doi.org/10.1016/j.palaeo.2025.112832
  • Barbour T (1908) Some new reptiles and amphibians. Bulletin of the Museum of Comparative Zoology at Harvard College 51: 315–325.
  • Barbour T (1909) Notes on Amphibia and Reptilia from eastern Asia. Proceedings of the New England Zoological Club 4: 53–78.
  • Blair C, Orlov NL, Shi HT, Robert WM (2009) A taxonomic re-evaluation of Goniurosaurus hainanensis (Squamata: Eublepharidae) from Hainan Island, China. Russian Journal of Herpetology 16: 35–40.
  • Börner AR (1981) The genera of Asian eublepharine geckos and a hypothesis of their phylogeny. Miscellaneous Articles in Saurology 9: 1–14 [privately printed, Cologne].
  • Cai B, Xiang J, Wang YY, Rao DQ, Huang S, Wang YZ, Song ZB, Guo XG, Jiang JP (2022) An annotated list of lizards (Sauria: Squamata) recorded from the People’s Republic of China. Asian Herpetological Research 13: 64–74. http://dx.doi.org/10.16373/j.cnki.ahr.210020
  • Catchen J, Hohenlohe PA, Bassham S, Amores A, Cresko WA (2013) Stacks: An analysis tool set for population genomics. Molecular Ecology 22: 3124–3140. https://doi.org/10.1111/mec.12354
  • Chan KO, Grismer LL (2022) Size correction of morphometric data in herpetology: A review and tutorial. Herpetological Review 53: 239–247.
  • China Programme of Kadoorie Farm, Botanic Garden and Hainan Wildlife Conservation Centre of Hainan Provincial Forestry Department (2007) Hainan’s limestone biodiversity on the map. Tropical Forestry 35 (S1): 1–3.
  • Clark PU, Dyke AS, Shakun JD, Carlson AE, Clark J, Wohlfarth B, Mitrovica JX, Hostetler SW, McCabe AM (2009) The Last Glacial Maximum. Science 325: 710–714. https://doi.org/10.1126/science.1172873
  • Groth JG, Barrowclough GF (1999) Basal divergences in birds and the phylogenetic utility of the nuclear RAG-1 gene. Molecular Phylogenetics and Evolution 12: 115–123. https://doi.org/10.1006/mpev.1998.0603
  • Grismer LL (1987) Evidence for the resurrection of Goniurosaurus Barbour (Reptilia: Eublepharidae) with a discussion on geographic variation in Goniurosaurus lichtenfelderi. Acta Herpetologica Sinica 6: 43–47.
  • Grismer LL (1988) Phylogeny, taxonomy, classification, and biogeography of eublepharid geckos. In: Estes R, Pregill G (Eds) Phylogenetic Relationships of the Lizard Families: Essays Commemorating Charles L. Camp. Stanford University Press, Stanford, CA, 369–469.
  • Grismer LL (2000) Goniurosaurus murphyi Orlov and Darevsky: A junior synonym of Goniurosaurus lichtenfelderi Mocquard. Journal of Herpetology 34: 486–488.
  • Grismer LL, Ngo HN, Qi S, Wang YY, Le MD, Ziegler T (2021) Phylogeny and evolution of habitat preference in Goniurosaurus (Squamata: Eublepharidae) and their correlation with karst and granite-stream-adapted ecomorphologies in species groups from Vietnam. Vertebrate Zoology 71: 335–352. https://doi.org/10.3897/vz.71.e65969
  • Grismer LL, Shi H, Orlov NL, Ananjeva NB (2002) A new species of Goniurosaurus (Squamata: Eublepharidae) from Hainan Island, China. Journal of Herpetology 36: 217–224.
  • Grismer LL, Viets BE, Boyle LJ (1999) Two new continental species of Goniurosaurus (Squamata: Eublepharidae) with a phylogeny and evolutionary classification of the genus. Journal of Herpetology 33: 382–393.
  • Honda M, Kurita T, Toda M, Ota H (2014) Phylogenetic relationships, genetic divergence, historical biogeography and conservation of an endangered gecko, Goniurosaurus kuroiwae (Squamata: Eublepharidae), from the Central Ryukyus, Japan. Zoological Science 31: 309–320. https://doi.org/10.2108/zs130201
  • Hou M., Wu Y., Yang K., Zheng S., Yuan Z, Li P (2014) A missing geographic link in the distribution of the genus Echinotriton (Caudata: Salamandridae) with description of a new species from southern China. Zootaxa 3895: 89–102.
  • Huang PH, Wang TR, Li M, Chen ZK, Zhang Y, Xu Q, Liu YL (2024) RAD-seq data for Engelhardia roxburghiana provide insights into the palaeogeography of Hainan Island and its relationship to mainland China since the late Eocene. Palaeogeography, Palaeoclimatology, Palaeoecology 651: 112392. https://doi.org/10.1016/j.palaeo.2024.112392
  • Huang ZJ (1964) Two new records of Chinese reptiles from Hainan–Eublepharis macularius and Typhlops diardi. Acta Zoologica Sinica 16: 494–495.
  • Husson F, Josse J, Le S, Mazet J (2017) FactoMineR: Multivariate Exploratory Data Analysis and Data Mining with R. R package version 1.39. R Foundation for Statistical Computing, Vienna, Austria. https://CRAN.R-project.org/package =FactoMineR
  • Jonniaux P, Kumazawa Y (2008) Molecular phylogenetic and dating analyses using mitochondrial DNA sequences of eyelid geckos (Squamata: Eublepharidae). Gene 407: 105–115. https://doi.org/10.1016/j.gene.2007.09.023
  • Kalyaanamoorthy S, Minh BQ, Wong TKF, von Haeseler A, Jermiin LS (2017) ModelFinder: Fast model selection for accurate phylogenetic estimates. Nature Methods 14: 587–589. https://doi.org/10.1038/nmeth.4285
  • Kassambara A, Mundt F (2017) factoextra: Extract and Visualize the Results of Multivariate Data Analyses. R package version 1.0.5. R Foundation for Statistical Computing, Vienna, Austria. https://CRAN.R-project.org/package =factoextra
  • Katoh K, Standley DM (2013) MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Molecular biology and evolution 30: 772–780. https://doi.org/10.1093/molbev/mst010
  • Kaverkin Y (2000) Eublepharoide Geckos der Gattung Goniurosaurus Barbour, 1908 – Haltung und Zucht im Terrarium. Sauria 22: 17–22.
  • Kluge AG (1967) Higher taxonomic categories of gekkonid lizards and their evolution. Bulletin of the American Museum of Natural History 135: 1–59.
  • Kluge AG (1987) Cladistic relationships in the Gekkonoidea (Squamata, Sauria). Miscellaneous Publications of the Museum of Zoology, University of Michigan 173: 1–53
  • Kocher TD, Thomas WK, Meyer A, Edwards SV, Pääbo S, Villablanca FX, Wilson AC (1989) Dynamics of mitochondrial DNA evolution in animals: Amplification and sequencing with conserved primers. Proceedings of the National Academy of Sciences of the USA 86: 6196–6200. https://doi.org/10.1073/pnas.86.16.6196
  • Kurita T, Honda M, Toda M (2008) Species delimitation and biogeography of the Ryukyu ground geckos, Goniurosaurus kuroiwae ssp. (Squamata: Eublepharidae), by use of mitochondrial and nuclear DNA analyses. Journal of Zoolological Systematics and Evolutionary Research 56: 209–222. https://doi.org/10.1111/jzs.12198
  • Kurita T, Toda M (2024) Genetic and morphological studies on Goniurosaurus kuroiwae (Squamata: Eublepharidae), with a description of a new species from the northern part of Okinawajima Island, Ryukyu Archipelago, Japan. Current Herpetology 43: 86–114.
  • Lambeck K, Rouby H, Purcell A, Sun Y, Sambridge M (2014) Sea level and global ice volumes from the Last Glacial Maximum to the Holocene. Proceedings of the National Academy of Sciences of the USA 111: 15296–15303. https://doi.org/10.1073/pnas.1411762111
  • Lanfear R, Frandsen PB, Wright AM, Senfeld T, Calcott B (2017) PartitionFinder 2: New methods for selecting partitioned models of evolution for molecular and morphological phylogenetic analyses. Molecular Biology and Evolution 34: 772–773. PMID: 28013191. https://doi.org/10.1093/molbev/msw260
  • Liang B, Zhou RB, Liu YL, Chen B, Grismer LL, Wang N (2018) Renewed classification within Goniurosaurus (Squamata: Eublepharidae) uncovers the dual roles of a continental island (Hainan) in species evolution. Molecular Phylogenetics and Evolution 127: 646–654. https://doi.org/10.1016/j.ympev.2018.06.011
  • Lin LH, Ji X, Diong CH, Du Y, Lin CX (2010) Phylogeography and population structure of the Reevese’s butterfly lizard (Leiolepis reevesii) inferred from mitochondrial DNA sequences. Molecular Phylogenetics and Evolution 56: 601–607. https://doi.org/10.1016/j.ympev.2010.04.032
  • Lleonart J, Salat J, Torres GJ (2000) Removing allometric effects of body size in morphological analysis. Journal of Theoretical Biology 205: 85–93.
  • Minh BQ, Schmidt HA, Chernomor O, Schrempf D, Woodhams MD, von Haeseler A, Lanfear R (2020) IQ-TREE 2: New models and efficient methods for phylogenetic inference in the genomic era. Molecular Biology and Evolution 37: 1530–1534. https://doi.org/10.1093/molbev/msaa015
  • Mocquard F (1897) Notes herpétologiques. Bulletin du Muséum national d’Histoire naturelle 3: 211–217.
  • National Forestry and Grassland Administration and Ministry of Agriculture and Rural Affairs of the People’s Republic of China (2021) List of National Key Protected Wild Animals in China. https://www.forestry.gov.cn/ [accessed 1 February 2025].
  • Ngo HN, Nguyen HQ, Tran HM, Ngo HT, Le MD, Gewiss LR, van Schingen-Khan M, Nguyen TQ, Ziegler T (2021) A morphological and molecular review of the genus Goniurosaurus, including an identification key. European Journal of Taxonomy 751: 38–67. https://doi.org/10.5852/ejt.2021.751.1379
  • Nguyen TQ (2011) Systematics, Ecology, and Conservation of the Lizard Fauna in Northeastern Vietnam, with Special Focus on Pseudocalotes (Agamidae), Goniurosaurus (Eublepharidae), Sphenomorphus and Tropidophorus (Scincidae) from this Country. PhD thesis, University of Bonn, Bonn, 229 pp.
  • Oksanen J, Blanchet FG, Friendly M, Kindt R, Legendre P, McGlinn D, Minchin PR, O’Hara RB, Simpson GL, Solymos P, Stevens MHH, Szoecs E, Wagner H (2020) vegan: Community Ecology Package. R package version 2.5-7. R Foundation for Statistical Computing, Vienna. https://CRAN.R-project.org/package =vegan
  • Orlov NL, Ananjeva NB, Nguyen TT (2020) New record and distribution of the genus Goniurosaurus Barbour, 1980 (Eublepharidae, Sauria, Reptilia) in Vietnam. Russian Journal of Herpetology 27: 179–184.
  • Orlov NL, Darevsky IS (1999) Description of a new mainland species of Goniurosaurus genus, from the north-eastern Vietnam. Russian Journal of Herpetology 6: 72–78.
  • Pagès J (2015) Multiple factor analysis by example using R. CRC Press, Boca Raton, FL, 272 pp.
  • Pope CH (1935) The Reptiles of China. Turtles, Crocodilians, Snakes, Lizards. Natural History of Central Asia 10. American Museum of Natural History, New York, NY, 604 pp.
  • Qi S, Grismer LL, Lyu ZT, Zhang L, Li PP, Wang YY (2020a) A definition of the Goniurosaurus yingdeensis group (Squamata, Eublepharidae) with the description of a new species. ZooKeys 986: 127–155. https://doi.org/10.3897/zookeys.986.47989
  • Qi S, Wang J, Grismer LL, Chen H-H, Lyu Z-T, Wang Y-Y (2020b) The stoor hobbit of Guangdong: Goniurosaurus gollum sp. nov., a cave-dwelling leopard gecko (Squamata, Eublepharidae) from South China. ZooKeys 991: 137–153. https://doi.org/10.3897/zookeys.991.54935
  • R Core Team (2024) R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna. https://www.R-project.org
  • Reist JD (1986) An empirical evaluation of coefffcients used in residual and allometric adjustment of size covariation. Canadian Journal of Zoology 64: 1363–1368. https://doi.org/10.1139/z86-203
  • Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61: 539–542. https://doi.org/10.1093/sysbio/sys029
  • Schmidt KP (1927) The reptiles of Hainan. Bulletin of the American Museum of Natural History 54: 395–465.
  • Shi HT, Zhao EM, Wang LJ (2011) The Amphibia and Reptilia Fauna of Hainan. Science Press, Beijing, 285 pp. [in Chinese].
  • Siddall M, Rohling EJ, Almogi-Labin A, Hemleben C, Meischner D, Schmelzer I, Smeed DA (2003) Sea-level fluctuations during the last glacial cycle. Nature 423: 853–858. https://doi.org/10.1038/nature01690
  • Simon C, Frati F, Beckenbach A, Crespi B, Liu H, Flook P (1994) Evolution, weighting and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Annals of the Entomological Society of America 87: 651–701.
  • Smith MA (1935) The Fauna of British India, including Ceylon and Burma. Reptilia and Amphibia. Vol. II Sauria. Taylor and Francis, London, 440 pp.
  • Talavera G, Castresana J (2007) Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments. Systematic Biology 56: 564–577.
  • Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: Molecular evolutionary genetics analysis version 6.0. Molecular Biology and Evolution 30: 2725–2729.
  • Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The CLUSTAL_X windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic acids research 25: 4876–4882.
  • Thorpe RS (1975) Quantitative handling of characters useful in snake systematics with particular reference to intraspecific variation in the ringed snake Natrix natrix (L). Biological Journal of the Linnean Society 7: 27–43.
  • Thorpe RS (1983) A review of the numerical methods for recognizing and analyzing racial differentiation. Numerical Taxonomy, NATO ASI Series (Series G: Ecological Sciences) 1: 404–423.
  • Turan C (1999) A note on the examination of morphometric differentiation among fish populations: The Truss system. Turkish Journal of Zoology 23: 259–263.
  • Wang YY, Jin MJ, Li YL, Grismer LL (2014) Description of a new species of Goniurosaurus (Squamata: Eublepharidae) from the Guangdong Province, China, based on molecular and morphological data. Herpetologica 70: 309–322. https://doi.org/10.1655/HERPETOLOGICA-D-13-00080
  • Xie J, Chen Y, Cai G, Cai R, Hu Z, Wang H (2023) Tree visualization by one table (tvBOT): A web application for visualizing, modifying and annotating phylogenetic trees. Nucleic Acids Research 51: W587–W592. https://doi.org/10.1093/nar/gkad359
  • Zhao EM, Adler KK (1993) Herpetology of China. Contributions to Herpetology 10. Society for the Study of Amphibians and Reptiles. Oxford, OH, 522 pp.
  • Zhou R, Peng X, Hou M, Yuan F (2019) A new species of genus GoniurosaurusG. sinensis. Journal of Shihezi University (Natural Science) 37: 549–556.
  • Zhou RB, Wang N, Chen B, Liang B (2018) Morphological evidence uncovers a new species of Goniurosaurus (Squamata: Eublepharidae) from the Hainan Island, China. Zootaxa 4369: 281–291. https://doi.org/10.11646/zootaxa.4369.2.8
  • Zhu XY, Chen GY, Román-Palacios C, Li Z, He ZQ (2020a) Goniurosaurus gezhi sp. nov., a new gecko species from Guangxi, China (Squamata: Eublepharidae). Zootaxa 4852: 211–222. https://doi.org/10.11646/zootaxa.4852.2.6
  • Zhu XY, Liu YJ, Bai YU, Roman-Palacios CR, Li Z, He ZQ (2021) Goniurosaurus chengzheng sp. nov., a new species of leopard gecko from Guangxi, China (Squamata: Eublepharidae). Zootaxa 4996: 555–568. https://doi.org/10.11646/zootaxa.4996.3.8
  • Zhu XY, Shen CZ, Liu YF, Chen L, Li Z, He ZQ (2020b) A new species of Goniurosaurus from Hainan Island, China based on molecular and morphological data (Squamata: Sauria: Eublepharidae). Zootaxa 4772: 349–360. https://doi.org/10.11646/zootaxa.4772.2.6
  • Zhu XY, Wu SY, Liu YJ, Bai Y, Román-Palacios CR, Li Z, He ZQ (2022) Goniurosaurus wangshu sp. nov., a new species of tiger gecko from Guangdong, China (Squamata: Eublepharidae). Zootaxa 5188: 544–558. https://doi.org/10.11646/zootaxa.5188.6.3
  • Ziegler T, Nguyen TQ, Schmitz A, Stenke R, Rösler H (2008) A new species of Goniurosaurus from Cat Ba Island, Hai Phong, Northern Vietnam (Squamata: Eublepharidae). Zootaxa 1771: 16–30. https://doi.org/10.11646/zootaxa.1771.1.2

Appendix 1

Specimens of the genus Goniurosaurus examined in this study.

Goniurosaurus bawanglingensis (15 ♂♂, 10 ♀♀). China: Hainan: National Park of Hainan Tropical Rainforest Bawangling Area: MVZ 230973 (holotype), LSUHC 4233, LSUHC 4234, LSUHC 4236, LSUHC 4252, SYS r002162 (6 ♂♂), LSUHC 4230–LSUHC 4232 (3 ♀♀); Ledong Li Autonomous County: HNNU 2016101311, HNNU 2016101312, HNNU 2016101314 (3 ♂♂), HNNU 2017052721, HNNU 2017052725 (2 ♀♀); Dongfang City: HNNU 2017111201–HNNU 2017111204, HNNU 2017111210 (5 ♂♂), HNNU 2017111205–HNNU 2017111209 (5 ♀♀). — Note: Specimens from LSUHC are preserved at Hainan Normal University.

Goniurosaurus hainanensis (11 ♂♂, 6 ♀♀). China: Hainan: Sanya City: Ganzaling Provincial Nature Reserve: HNNU 2018102902–HNNU 2018102905, HNNU 2018102907–HNNU 2018102909 (7 ♂♂), HNNU 2018102901, HNNU 2018102906, HNNU 2018102910 (3 ♀♀); National Park of Hainan Tropical Rainforest Maorui Area: HNNU 2020070301 (1 ♂); Wuzhishan City: SYS r002530 (1 ♂), SYS r002529 (1 ♀); National Park of Hainan Tropical Rainforest Jianfengling Area: ECNU-V0003, ECNU-V0059 (2 ♂♂), ECNU-V0004 and ECNU-V0005 (2 ♀♀) (type series of G. kwanghua).

Goniurosaurus cf. lichtenfelderi (20 ♂♂, 18 ♀♀). China: Hainan: Wenchang City: Tongguling National Nature Reserve: HNNU 2018061001, HNNU 2017111301–HNNU 2017111303, HNNU 2017102101 (5 ♂♂), HNNU 2018061002–HNNU 2018061004 (3 ♀♀); Haikou City: HNNU 2018051802, HNNU 2018051804, HNNU 2018051807 (3 ♂♂), HNNU 2018051801, HNNU 2018051803, HNNU 2018051805, HNNU 2018051806, HNNU 2018051808–HNNU 2018051811 (8 ♀♀); Wanning City: Dazhou Island: HNNU 2020060601 (1 ♂); National Park of Hainan Tropical Rainforest Diaoluoshan Area: HNNU 2018041301 (1 ♂); HNNU 2018041302, HNNU R0433 (2 ♀♀); Baoting Li and Miao Autonomous County: Qixianling National Forest Park: HNNU 201710, HNNU 20171013019 (2 ♂♂); Qionghai City: HNNU qionghai02, HNNU 2018060303, HNNU 2018060304 (3 ♂♂), HNNU qionghai03, HNNU 2018060301, HNNU 2018060302 (3 ♀♀); Limushan Provincial Nature Reserve: HNNU 20181028, HNNU 2018102807–HNNU 2018102809, HNNU 2018102811 (5 ♂♂), HNNU 2018102802, HNNU 2018102806 (2 ♀♀).

Goniurosaurus zhoui (7 ♂♂, 10 ♀♀). China: Hainan: Baisha Li Autonomous County: SYS a002213, HNNU 2017072621(2 ♂♂), SYS a002214, HNNU 2017072622, HNNU 2017072623, HNNU 2020071501, HNNU 2020071502 (5 ♀♀); National Park of Hainan Tropical Rainforest Yinggeling Area: HNNU 2017070801, HNNU 2017070804, HNNU 2017070805, HNNU 2017070809, HNNU 2017070811 (5 ♂♂), HNNU 2017070802, HNNU 2017070803, HNNU 2017070806, HNNU 2017070812, HNNU 2017070813 (5 ♀♀).

Supplementary material

Supplementary material 1 

Tables S1–S3

Qi S, Ngo HN, Grismer LL, Wang H-T, Song H-M, Zhu X-Y, He Z-Q, Zhou Z, Wang J-C, Li P-P, Wang Y-Y (2025)

Data type: .zip

Explanation notes: Table S1. The multiple factor analysisdataset [.xlsx-file]. — Table S2. Sample list of genus Goniurosaurus and outgroups for phylogenetic analysis in this study. All sequences beginning with “C_” represent GenBase accession numbers, whereas all other sequences correspond to GenBank accession numbers [.docx-file]. — Table S3. List of samples and genetic loci used in molecular dating analyses [.docx-file].

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (107.54 kb)
login to comment