Research Article |
|
Corresponding author: Shuo Qi ( qishuo1992@outlook.com ) Corresponding author: Ying-Yong Wang ( wangyy@mail.sysu.edu.cn ) Academic editor: Uwe Fritz
© 2025 Shuo Qi, Hai Ngoc Ngo, L. Lee Grismer, Hao-Tian Wang, Han-Ming Song, Xiao-Yu Zhu, Zhu-Qing He, Zi-Chen Zhou, Pi-Peng Li, Ji-Chao Wang, Ying-Yong Wang.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Qi S, Ngo HN, Grismer LL, Wang H-T, Song H-M, Zhu X-Y, He Z-Q, Zhou Z-C, Li P-P, Wang J-C, Wang Y-Y (2025) Integrative taxonomic revision of the Goniurosaurus lichtenfelderi group (Squamata: Eublepharidae): Insights from morphological and molecular data. Vertebrate Zoology 75: 673-698. https://doi.org/10.3897/vz.75.e158031
|
Understanding the taxonomy of the Goniurosaurus lichtenfelderi group has long been obscured by limited sampling, inconsistent morphological characters, and a lack of publicly available molecular and distribution data. In this study, we conducted the most comprehensive morphological and molecular assessment of this group to date, integrating extensive sampling from Hainan Island and adjacent mainland regions. Phylogenetic analyses using mitochondrial and nuclear genes, along with SNPs delivered from ddRAD-seq, revealed that G. hainanensis is polyphyletic, consisting of two deeply divergent clades (i.e., western and eastern) on Hainan Island. The western clade, from the type locality at Mt. Wuzhi, shows small genetic divergence from G. sinensis (= G. kwanghua), supporting their synonymy. In contrast, the eastern clade is genetically more closely related to the continental G. lichtenfelderi than to its western counterpart. Divergence time estimates further indicate that the eastern and western Hainan populations have distinct evolutionary histories. Based on integrated evidence, we synonymize G. kwanghua and G. sinensis with G. hainanensis, and delimit the eastern Hainan clade as G. cf. lichtenfelderi, pending further morphological confirmation. Consequently, the number of valid species in the G. lichtenfelderi group is revised from five to four (including G. lichtenfelderi, G. hainanensis, G. bawanglingensis, and G. zhoui). In addition, a revised taxonomic account and updated distribution information for all recognized species are provided in this study.
ddRAD-seq, Hainan Island, molecular phylogeny, synonym, systematics, tiger geckos
Pleistocene sea-level fluctuations repeatedly reshaped geographic landscapes and biogeographic patterns worldwide, periodically connecting and isolating landmasses and thus influencing the distribution and diversification of organisms (
The genus Goniurosaurus, currently comprises 26 extant species (
The taxonomy of the G. lichtenfelderi group has remained controversial for decades, with several key issues still unresolved.
Since the 2010s, recent descriptions of new species using molecular data supported the establishment of molecular phylogenies.
Thus far, seven nominal species have been described in the G. lichtenfelderi group, of which five are currently recognized as valid species, including, G. lichtenfelderi (Mocquard, 1897), G. hainanensis Barbour, 1908, G. bawanglingensis Grismer, Shi, Orlov & Ananjeva, 2002, G. zhoui Zhou, Wang, Chen & Liang, 2018, and G. sinensis Zhou, Peng, Hou & Yuan, 2019. These species are distributed from northern Vietnam including islands of the Beibu Gulf (= Gulf of Tonkin), through the China-Vietnam border, to southern Guangxi, Hainan Island, and adjacent islands, China. Among them, four species are only known to occur on Hainan Island, China, excluding G. lichtenfelderi.
Although these studies have advanced our understanding of the evolutionary relationships and potential species diversity within the G. lichtenfelderi group, the taxonomic uncertainties regarding G. lichtenfelderi, G. hainanensis, G. sinensis and its junior synonym G. kwanghua remain unresolved. This is because previous taxonomic work was based on limited and discontinuous sampling and lacked comparisons to topotypic material. Molecular and morphological data were obtained selectively from isolated localities to analyze lineage structures and relationships, leading to erroneous conclusions based on incomplete evidence. Furthermore, such selective sampling resulted in an overreliance on genetic differentiation and molecular phylogenetic trees, with morphology serving as supplementary evidence, and weakened by the use of limited specimens, ultimately contributing to biased and misleading conclusions. In addition, the undisclosed type specimen information and the opacity of type localities have further impeded the taxonomic progress.
To address these gaps, we conducted an integrative taxonomic revision of the G. lichtenfelderi group using the most extensive molecular dataset assembled to date, including topotypic samples and genome-wide single nucleotide polymorphism (SNP) data. Using this approach, we aim to explore and clarify the systematics of the group and propose taxonomic changes that will better reflect its evolutionary history and maintain monophyly.
We examined 97 preserved specimens of Goniurosaurus, including 25 specimens of G. bawanglingensis, four of G. sinensis (= G. kwanghua; = G. hainanensis sensu stricto in results), 38 of G. hainanensis from the east side of the island (= G. cf. lichtenfelderi in results) and 13 of G. hainanensis (= G. hainanensis sensu stricto in results) from the west side of the island, and 17 of G. zhoui. Due to the poor preservation of some specimens, only 23 of G. bawanglingensis, 24 of G. hainanensis from the east side of the island, 13 of western clade G. hainanensis, and 18 of G. zhoui were included in the subsequent statistical analyses. The specimens examined in this study are deposited in
The morphological characters examined followed
All statistical analyses were conducted using R version 4.4.2 (
A PERMANOVA analysis from the vegan package 2.5–3 in R (
One-way analysis of variance (ANOVA) was performed on a dataset coded for species to examine statistically significant mean differences (p < 0.05) among characters using car R package. Character means showing significant differences were subjected to a Tukey HSD test to determine which pairs of species differed significantly for those specific characters. Violin plots and the inserted/independent boxplots were generated to visualize the range, frequency, mean, 50% quartile, and degree of differences between the dependent variables for datasets with statistically significant mean differences using ggplot2 R package.
Mitochondrial and nuclear DNA. Seventy-eight newly collected samples of Goniurosaurus geckos were used in this study, including 53 from the G. lichtenfelderi group, 18 from the G. luii group, and 7 from the G. yingdeensis group. All Goniurosaurus specimens were collected during field surveys from 2014 to 2023. Prior to February 5th, 2021—the date on which the newly revised List of National Key Protected Wild Animals in China (National Forestry and Grassland Administration and Ministry of Agriculture and Rural Affairs of the People’s Republic of China 2021) came into effect, specimens were retained as vouchers, and tissues for DNA extraction were mainly taken from muscle or tail tips. After this date, specimens were no longer retained but were released at the site of capture following non-lethal sampling, with either oral swabs or tail tip tissue collected for molecular analyses. This protocol was implemented to ensure full compliance with updated national wildlife protection regulations, which prohibit the long-term removal of protected species from the wild. DNA was extracted from each tissue sample using a standard extraction kit (Tiangen Biotech, Beijing, China). Two mitochondrial genomic fragments with 495 base pairs (bp) of 16S ribosomal RNA (16S) and 396 bp of cytochrome b (cyt b) and two nuclear genes with 369 base pairs (bp) of C-mos and 990 bp of Rag1 were amplified in this study. Primers used in this study are listed in Table
For the Vietnamese samples, DNA was extracted and amplified at Hanoi University of Science (HUS), Hanoi, Vietnam, following the protocol described in
A total of 561 sequences were used in the phylogenetic analyses, including 543 sequences of Goniurosaurus species and 18 outgroup sequences (see Table S2 for detail). Among them, 280 newly sequenced data have been deposited in GenBase (https://ngdc.cncb.ac.cn/genbase), and all other sequences were downloaded from GenBank (https://www.ncbi.nlm.nih.gov/genbank).
| Locus and description | Primer name | Primer sequence (5’-3’) | Sources |
| 16S | r16S-5L | GGTMMYGCCTGCCCAGTG |
|
| 16sbr-H | CCGGTCTGAACTCAGATCACGT |
|
|
| cyt b | L14731 | TGGTCTGAAAAACCATTGTTG |
|
| H15149m | GCMCCTCAGAAKGATATTTGYCCTCA |
|
|
| C-mos | FU-F | TTTGGTTCKGTCTACAAGGCTAC |
|
| FU-R | AGGGAACATCCAAAGTCTCCAAT |
|
|
| Rag1 | R13 | TCTGAATGGAAATTCAAGCTGTT |
|
| R18 | GATGCTGCCTCGGTCGGCCACCTTT |
|
ddRAD library preparation and sequencing. To further evaluate putative species boundaries and clades recovered in the Sanger sequencing analyses in a more genomically comprehensive context, a small subset of samples was selected for double-digest restriction site-associated DNA sequencing (ddRAD-seq). Genomic DNA was extracted from 76 individuals of the G. lichtenfelderi group, as well as an outgroup sample of G. yingdeensis, using a universal DNA extraction kit (GenStar, Beijing, China), following the manufacturer’s instructions. DNA quality and concentration were assessed by agarose gel electrophoresis and a Qubit fluorometer (Thermo Fisher Scientific, USA). Library construction and sequencing were conducted by Guangzhou Jierui Bioscience & Technology Inc. Briefly, 200 ng of genomic DNA from each sample was digested with EcoRI and PstI (New England Biolabs, USA) and ligated to adapters containing unique barcodes and compatible overhangs using T4 DNA ligase (New England Biolabs). Barcoded samples were pooled in equal volumes, and fragments in the 350–550 bp range were isolated through agarose gel electrophoresis and purified (Omega Bio-tek, Nocross, USA). The pooled library was PCR-amplified and sequenced on an Illumina NovaSeq platform using 150 bp paired-end reads.
ddRAD-seq bioinformatics and SNP calling. Raw reads were demultiplexed and quality-filtered with the process_radtags module in Stacks v2.6 (
Sequence-based phylogenetic inference. DNA sequences were aligned using the MAFFT algorithm (
To further examine genetic divergence, uncorrected pairwise sequence distances for the cyt b gene were calculated in MEGA 6 (
SNP-based Structure and ML Tree Inference. We used a model-based clustering approach implemented in STRUCTURE v2.3.4 (
To reconstruct phylogenetic relationships, we reconstructed a maximum likelihood (ML) tree based on the SNP dataset. A concatenated alignment including one SNP per RAD locus was generated in PHYLIP format using Stacks output. Tree inference was performed in IQ-TREE v2.0, which selected the best-fit substitution model via ModelFinder. Branch support was assessed with 1000 ultrafast bootstrap replicates. The resulting tree provided a well-resolved phylogeny of the G. lichtenfelderi group. An outgroup from a congeneric species outside the group was used for rooting, allowing interpretation of evolutionary direction. All analyses were conducted with default parameters unless specified otherwise, and the final tree was visualized using TVBOT v2.6.1.
Dating analyses. We estimated divergence times using PAML v4.9j (Yang 2007) based on a concatenated dataset of four genetic markers. A relaxed molecular clock model (clock = 2) was applied to account for rate variation among lineages. The F84 model was used to model nucleotide substitution rates, as determined by prior model testing. The approximate likelihood method (usedata = 2) was employed to improve computational efficiency for large datasets. Among-site rate heterogeneity was modeled using a gamma distribution with a shape parameter (alpha = 0.5) and five discrete categories (ncatG = 5).
Priors were set following standard practice: the mean substitution rate prior (rgene_gamma) was set with α = 2 and β = 20 (corresponding to 0.1 substitutions/site/100 million years ago, Mya), and the rate variance across branches prior (sigma2_gamma) was defined as α = 1 and β = 10. MCMC chains were run for 6,000,000 iterations, sampling every 10 iterations, with a burn-in of 1,000,000, resulting in 500,000 samples used for posterior estimation. Convergence was verified using standard diagnostics.
As there are no reliable fossil records for Goniurosaurus, we applied secondary calibrations based on divergence estimates within Eublepharidae (Agarwal et al. 2022). Additionally, three fossil calibrations from Gekkota (Agarwal et al. 2020) were used: Burmese amber fossils for crown Gekkota (offset = 99 Mya); Pygopus hortulanus for the stem of Pygopus (offset = 23 Mya); the divergence between Phelsuma inexpectata and P. ornata (uniform prior: 0.05–5 Mya). We also included the earliest fossil record of Tarentola (offset = 11.6 Mya) as a genus-level constraint. Final divergence estimates are reported as medians with 95% highest posterior density (HPD) intervals in millions of years ago (Mya). Sample information for dating analyses see Table S3.
Phylogenetic inference from mitochondrial and nuclear DNA. In Figure
A The Bayesian inference (BI) phylogenetic tree and the Maximum likelihood (ML) phylogenetic tree of family Eublepharidae and Goniurosaurus lichtenfelderi group, inferred by two mitochondrial gene fragments (16S and cyt b) and two nuclear gene fragments (C-mos and Rag1). B The haplotype network structure, based on cyt b gene, the black circles represent missing haplotypes in the mutation process. More details of the abbreviations of locations are included in Table S2.
Sample size and mean intra- and interspecific genetic distances of Goniurosaurus species based on mitochondrial cyt b sequences.
| Species | Sample size | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | 20 | 21 | 22 | 23 | 24 | 25 | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | G. kuroiwae | 2 | 1.30 | ||||||||||||||||||||||||
| 2 | G. nebulozonatus | 2 | 6.77 | 0.00 | |||||||||||||||||||||||
| 3 | G. orientalis | 2 | 6.25 | 8.07 | 0.00 | ||||||||||||||||||||||
| 4 | G. sengokui | 2 | 5.86 | 6.77 | 5.99 | 0.00 | |||||||||||||||||||||
| 5 | G. splendens | 2 | 13.93 | 16.93 | 15.10 | 13.80 | 0.52 | ||||||||||||||||||||
| 6 | G. toyamai | 2 | 5.21 | 7.16 | 7.42 | 5.34 | 14.71 | 0.26 | |||||||||||||||||||
| 7 | G. yamashinae | 1 | 6.51 | 5.99 | 6.77 | 5.47 | 14.84 | 6.64 | n/a | ||||||||||||||||||
| 8 | G. bawanglingensis | 14 | 24.00 | 23.64 | 25.24 | 23.87 | 27.16 | 23.10 | 23.34 | 3.29 | |||||||||||||||||
| 9 | G. hainanensis | 14 | 23.21 | 24.83 | 24.13 | 24.39 | 24.78 | 23.21 | 23.08 | 16.96 | 2.43 | ||||||||||||||||
| 10 | G. lichtenfelderi | 8 | 22.71 | 23.52 | 24.53 | 23.59 | 26.07 | 22.58 | 23.02 | 15.88 | 6.87 | 2.19 | |||||||||||||||
| 11 | G. cf. lichtenfelderi | 18 | 22.82 | 22.88 | 24.25 | 23.60 | 26.92 | 22.30 | 23.08 | 15.31 | 7.15 | 5.32 | 2.39 | ||||||||||||||
| 12 | G. zhoui | 16 | 23.31 | 23.76 | 23.70 | 24.84 | 24.25 | 24.25 | 23.34 | 16.69 | 13.67 | 13.74 | 14.24 | 1.68 | |||||||||||||
| 13 | G. araneus | 5 | 18.49 | 18.49 | 19.79 | 19.53 | 21.07 | 18.36 | 20.31 | 20.06 | 21.01 | 20.26 | 20.77 | 18.66 | 0.21 | ||||||||||||
| 14 | G. catbaensis | 2 | 19.27 | 19.79 | 20.31 | 20.83 | 22.01 | 19.40 | 21.09 | 20.15 | 19.92 | 21.02 | 20.21 | 18.51 | 12.08 | 0.00 | |||||||||||
| 15 | G. chengzheng | 2 | 18.88 | 19.14 | 19.66 | 18.88 | 20.83 | 18.49 | 17.84 | 19.61 | 19.96 | 19.58 | 20.21 | 17.76 | 9.87 | 11.85 | 0.26 | ||||||||||
| 16 | G. gezhi | 4 | 19.34 | 19.86 | 19.86 | 19.08 | 20.25 | 18.42 | 19.60 | 20.84 | 20.49 | 20.59 | 20.54 | 19.21 | 10.07 | 12.04 | 6.18 | 0.13 | |||||||||
| 17 | G. huuliensis | 4 | 20.96 | 20.70 | 21.48 | 20.83 | 22.85 | 19.27 | 20.96 | 18.70 | 21.51 | 21.08 | 20.74 | 20.41 | 11.50 | 11.26 | 10.22 | 11.46 | 0.39 | ||||||||
| 18 | G. kwangsiensis | 4 | 18.36 | 19.14 | 20.18 | 20.18 | 20.83 | 18.95 | 20.31 | 18.79 | 22.04 | 20.55 | 20.67 | 19.04 | 11.04 | 14.06 | 12.37 | 12.57 | 10.61 | 0.87 | |||||||
| 19 | G. liboensis | 5 | 20.31 | 20.36 | 21.82 | 21.25 | 22.32 | 20.08 | 20.73 | 19.11 | 21.15 | 20.26 | 20.05 | 18.86 | 11.93 | 15.26 | 11.17 | 12.67 | 10.22 | 7.50 | 1.51 | ||||||
| 20 | G. luii | 8 | 18.68 | 19.53 | 19.50 | 19.56 | 22.14 | 17.90 | 19.82 | 18.17 | 21.69 | 21.08 | 20.41 | 20.12 | 10.68 | 12.14 | 10.12 | 10.06 | 3.24 | 9.47 | 9.99 | 0.90 | |||||
| 21 | G. gollum | 3 | 22.53 | 22.40 | 23.70 | 23.70 | 23.44 | 22.66 | 22.14 | 22.08 | 21.30 | 22.42 | 21.78 | 22.44 | 20.42 | 21.61 | 21.48 | 21.42 | 21.29 | 19.01 | 19.27 | 20.67 | 0.00 | ||||
| 22 | G. varius | 7 | 23.75 | 22.51 | 23.92 | 24.70 | 26.19 | 24.18 | 24.96 | 21.51 | 23.08 | 22.42 | 22.38 | 20.98 | 18.67 | 20.09 | 20.11 | 21.05 | 21.29 | 19.87 | 20.59 | 20.48 | 14.81 | 1.84 | |||
| 23 | G. wangshu | 6 | 23.09 | 22.79 | 23.91 | 24.00 | 22.18 | 23.13 | 22.44 | 21.78 | 21.31 | 22.22 | 21.26 | 23.04 | 19.59 | 21.74 | 22.40 | 20.94 | 22.46 | 21.40 | 22.25 | 21.45 | 10.89 | 14.27 | 4.39 | ||
| 24 | G. yingdeensis | 10 | 23.26 | 21.30 | 24.48 | 23.65 | 25.52 | 23.13 | 23.65 | 21.65 | 21.65 | 21.64 | 21.65 | 21.59 | 18.93 | 20.44 | 19.53 | 19.41 | 20.63 | 18.98 | 20.70 | 19.32 | 13.20 | 9.75 | 13.13 | 0.65 | |
| 25 | G. zhelongi | 10 | 22.84 | 21.35 | 23.18 | 23.44 | 24.45 | 23.83 | 23.18 | 19.99 | 20.19 | 21.07 | 20.05 | 19.20 | 16.54 | 17.79 | 17.34 | 19.10 | 20.49 | 18.41 | 19.40 | 19.58 | 11.61 | 7.28 | 12.93 | 8.19 | 0.28 |
Haplotype network analysis based on mitochondrial sequence (cyt b) revealed a clear pattern of genetic differentiation within the G. lichtenfelderi group (Fig.
Taken together, the phylogenetic results suggest that the taxon currently referred to as G. hainanensis on Hainan Island may comprise two deeply divergent evolutionary lineages, but this inference requires further validation with higher-resolution genomic data.
Phylogenetic inference from SNP data. The maximum likelihood (ML) tree inferred from concatenated SNP data (one SNP per locus) recovered five distinct clades, each corresponding to putatively independent lineages (Fig.
Genetic relationships and population structure of the Goniurosaurus lichtenfelderi group inferred from genome-wide SNPs. A Phylogenetic tree of the G. lichtenfelderi group based on SNP data derived from double-digest restriction-site associated DNA sequencing (ddRAD-seq), bootstrap supports (BS) less than 70 were left out; B Estimation of the optimal number of genetic clusters (K) based on ΔK values from STRUCTURE analysis; C Genetic structure of the G. lichtenfelderi group inferred from STRUCTURE analysis at the K value from 2 to 5. Abbreviations of localities: DDZ (Dongzhong town, Guangxi); RT (Rongtang village, Hainan); DL (Diaoluoshan, Hainan); QX (Qixianling, Hainan); FT (Fantong village, Hainan); MY (Maoyang town, Hainan); FH (Fenghuangling, Hainan); BWL (Bawangling, Hainan); JF (Tianchi, Jianfengling, Hainan); ZF (Main Peak, Jianfengling, Hainan); EX (Exianling, Hainan); NK (Nankai town, Hainan); WX (Wangxia town, Hainan).
Model-based clustering implemented in STRUCTURE, evaluated across K = 2–10, identified K = 3 as the optimal number of genetic clusters according to the ΔK method (Fig.
Divergence dating. The MCMCtree analysis (Fig.
Divergence time estimates place the most recent common ancestor (MRCA) of Eublepharidae at 82.9 Mya (95% HPD: 93–73 Mya). The divergence between Goniurosaurus and the clade comprising Eublepharis and two African genera occurred at 59.4 Mya (95% HPD: 67–53 Mya). Within Goniurosaurus, G. kuroiwae group diverged around 43.1 Ma (95% HPD: 53–34 Mya), followed by G. yingdeensis group at 34.2 Mya (95% HPD: 42–26 Mya), and finally, the divergence between the G. lichtenfelderi group and G. luii group occurred at 28.7 Mya (95% HPD: 36–22 Mya). Within the G. lichtenfelderi group, G. bawanglingensis is the earliest diverging lineage, with an estimated divergence time of 14.7 Mya (95% HPD: 20–10 Mya); followed by G. zhoui at 10.9 Mya (95% HPD: 15–7 Ma); Subsequently, two major clades emerged: one comprising G. lichtenfelderi and the eastern clade of G. hainanensis, and the other comprising the western clade of G. hainanensis and G. sinensis, with a divergence time of 5.3 Mya (95% HPD: 8–3 Mya). The divergence between G. lichtenfelderi and the eastern G. hainanensis clade occurred at 3.8 Mya (95% HPD: 6–2 Mya), while the western G. hainanensis clade diverged from G. sinensis much more recently, at 1.1 Mya (95% HPD: 2–0.3 Mya).
Divergence time tree of Gekkota, including the family Eublepharidae, inferred using MCMCtree from a combined dataset of two mitochondrial genes (16S and cyt b) and two nuclear genes (C-mos and Rag1). Algyroides fitzingeri (Lacertidae) was used as outgroup. Node calibrations were applied based on fossil and/or secondary calibration points (see Materials and Methods for details).
Statistics for morphometric data. The MFA and subsequent PERMANOVA recovered statistically different morpho-spatial differences among all species pairs except the eastern and western clades of G. hainanensis (Fig.
A Result of multiple factor analysis (MFA), the clustering of Goniurosaurus bawanglingensis, G. zhoui, G. cf. lichtenfelderi and G. hainanensis along dimensions 1 and 2 from the MFA. B The percent contribution of meristic and size-corrected morphometric characters of the first five dimensions of the MFA.
PERMANOVA summary statistics base on the MFA. Shaded cells represent species pairs bearing statistically different centroid positions.
| Pairs | F.Model | R2 | p.value | p.adjusted |
| cf. lichtenfelderi vs. hainanensis | 1.83841479 | 0.05129732 | 0.22043559 | 1 |
| cf. lichtenfelderi vs. bawanglingensis | 14.4823355 | 0.24347288 | 2.00E-05 | 0.00012 |
| cf. lichtenfelderi vs. zhoui | 8.36439893 | 0.17294537 | 0.00053999 | 0.00323994 |
| hainanensis vs. bawanglingensis | 2.98932118 | 0.08306134 | 8.00E-05 | 0.00047999 |
| hainanensis vs. zhoui | 1.93953808 | 0.06478183 | 0.0049799 | 0.0298794 |
| bawanglingensis vs. zhoui | 16.2723735 | 0.29440338 | 2.00E-05 | 0.00012 |
Species pairs of Goniurosaurus from Hainan Island bearing statistically different mean values in head length (HL), head width (HW), hind limb length (HLL), internarial distance (ID) and number of post mentals (PM). Numbers are the p values. Shaded cells are species pairs that are not significantly different.
| HL | bawanglingensis | zhoui | cf. lichtenfelderi | hainanensis |
| bawanglingensis | 2.71e-06 | 0.00018189 | ||
| zhoui | 2.71e-06 | 0.00010860 | ||
| cf. lichtenfelderi | 0.00010860 | 0.00336875 | ||
| hainanensis | 0.00018189 | 0.00336875 | ||
| HW | bawanglingensis | zhoui | cf. lichtenfelderi | hainanensis |
| bawanglingensis | 3.05e-05 | 0.01155973 | 2.27e-06 | |
| zhoui | 3.05e-05 | |||
| cf. lichtenfelderi | 0.01155973 | 0.01877897 | ||
| hainanensis | 2.27e-06 | 0.01877897 | ||
| HLL | bawanglingensis | zhoui | cf. lichtenfelderi | hainanensis |
| bawanglingensis | 1.36e-07 | 0.000128854 | 2.92e-08 | |
| zhoui | 1.36e-07 | |||
| cf. lichtenfelderi | 0.000128854 | 0.02222431 | ||
| hainanensis | 2.92e-08 | 0.02222431 | ||
| ID | bawanglingensis | zhoui | cf. lichtenfelderi | hainanensis |
| bawanglingensis | ||||
| zhoui | 7.22e-05 | |||
| cf. lichtenfelderi | 7.22e-05 | 0.00187905 | ||
| hainanensis | 0.00187905 | |||
| PM | bawanglingensis | zhoui | cf. lichtenfelderi | hainanensis |
| bawanglingensis | 0.02819262 | 6.74e-07 | ||
| zhoui | 0.02819262 | |||
| cf. lichtenfelderi | 6.74e-07 | 0.00621731 | ||
| hainanensis | 0.00621731 |
The results presented here provide a robust genetic framework for understanding species boundaries within the G. lichtenfelderi group. Both sequence- and SNP-based trees robustly support the distinctiveness of G. bawanglingensis and G. zhoui as independent evolutionary lineages. However, G. hainanensis is consistently recovered as polyphyletic, comprising two deeply divergent clades on Hainan Island. The western clade, which includes samples from the type locality Wuzhishan, clusters closely with G. sinensis in both sequence- and SNP-based phylogenies, with minimal genetic distance and recent divergence time estimates. Given this strong genetic continuity and the historical context of the type locality, we propose to treat G. sinensis as a junior synonym of G. hainanensis.
In contrast, the eastern clade of G. hainanensis forms a distinct lineage that is genetically closer to continental populations of G. lichtenfelderi than to its western counterpart. Moderate levels of genetic divergence exist between the eastern clade and G. lichtenfelderi, comparable to those observed between other recognized species within the genus (e.g., G. chengzheng vs. G. gezhi; G. luii vs. G. huuliensis). However, due to the lack of comprehensive morphological data for continental G. lichtenfelderi collected by the same observer and the absence of high-coverage genomic evidence to further evaluate the depth and consistency of divergence, we restrict the distribution of G. lichtenfelderi sensu stricto to the Asian mainland and tentatively treat the Hainan Island lineage as G. cf. lichtenfelderi. Future studies incorporating extensive morphological datasets and genome-wide data will be essential to determine whether this lineage warrants formal taxonomic recognition.
Family Eublepharidae Boulenger, 1883
Genus Goniurosaurus Barbour, 1908
This species group can be differentiated from the other species groups by the combination of the following characters: (1) No significant sexual dimorphism in body size, SVL 73.3–113.5 mm; (2) body and limbs robust; FLL/SVL ratio 0.29–0.31, HLL/SVL ratio 0.41–0.44; (3) 23–46 precloacal pores in males present, form a continuous transverse series extending onto the femora; precloacal pores in females usually absent, expect in a few cases of G. lichtenfelderi; (4) base of claws sheathed by four scales, two lateral scales of claw large, long, and curved; and (5) enlarged row of supraorbital tubercles distinct.
The species of G. lichtenfelderi group are distributed on Hainan Island, in the southwestern region of Guangxi Zhuang Autonomous Region, China, and in northeastern Vietnam. The westernmost record is located in Ba Vi District, west of the Red River, Vietnam (Fig.
Chresonymy.
Eublepharis macularius
—
霸王岭睑虎 (bà wáng lǐng jiǎn hǔ).
Bawangling leopard gecko, Bawangling tiger gecko.
Thach sung mi ba wang ling.
A Juvenile Goniurosaurus bawanglingensis from Jianfengling NR, photo by Yong-Heng Zhu; B adult Goniurosaurus bawanglingensis from Jianfengling NR, photo by Shuo Qi; C adult Goniurosaurus bawanglingensis from Bawangling NR, photo by Shuo Qi; D “Eublepharis macularius”, from Hainan Island, cited from
Ten paratypes in total, four adult females (R9907001, R9907003–04,
15 ♂♂, 10 ♀♀, see Appendix 1 for detail.
Based on the previous description (
Goniurosaurus bawanglingensis is an endemic species on Hainan Island, which is currently known from Changjiang Li Autonomous County (National Park of Hainan Tropical Rainforest, Bawangling Area, formerly Bawangling National Natural Reserve; Baomeiling Provincial Natural Reserve), Ledong Li Autonomous County (National Park of Hainan Tropical Rainforest, Jianfengling Area, formerly Jianfengling National Natural Reserve), Danzhou City (Nanfeng town), and Dongfang City (Jiangbian village), Hainan Province, China, at elevations of 400–750 m (
Synonymy.
Goniurosaurus sinensis Zhou, Peng, Hou & Yuan, 2019 syn. nov.
Goniurosaurus kwanghua Zhu & He, 2020
海南睑虎 (hǎi nán jiǎn hǔ).
Hainan leopard gecko, Hainan tiger gecko.
Thach sung mi hai nan.
Morphological comparison of adult Goniurosaurus sinensis syn. nov., Goniurosaurus hainanensis and Goniurosaurus lichtenfelderi. A1 Holotype of Goniurosaurus sinensis syn. nov. (BL-RBZ-102), cited from
Morphological comparison of juvenile Goniurosaurus lichtenfelderi with its three junior synonyms: A Goniurosaurus sinensis syn. nov., cited from
The holotype of Goniurosaurus hainanensis (
A juvenile male,
11 ♂♂, 6 ♀♀ from China, see Appendix 1 for detail.
Based on the previous description (
After this taxonomic revision, the distribution of G. hainanensis is restricted to the southern and southwestern regions of Hainan Island, at elevations of 30–800 m (
Although the precise type locality of G. hainanensis is not definitively recorded, we infer the northwestern slope of Mt. Wuzhi as the most probable area, considering historical accessibility, transportation, and manpower conditions at the time of collection. Goniurosaurus kwanghua was previously regarded as a junior synonym of G. sinensis (
Synonymy.
Eublepharis Lichtenfelderi Mocquard, 1897
Goniurosaurus murphyi Orlov & Darevsky, 1999
Goniurosaurus murhyi
—
里氏睑虎 (lǐ shì jiǎn hǔ).
Lichtenfelder’s gecko.
Thach sung mi lich-ten-phen-do.
Adult female MNHN-RA 1897.0091 and subadult female MNHN-RA 1897.0092, collected from îles Norway, baie d’Along, golfe du Tonkin, Vietnam; collected by Lichtenfelder (Probably Charles Lichtenfelder).
92 ♂♂, 72 ♀♀, 14 juveniles from Vietnam examined by Hai Ngoc Ngo (
Based on the previous description (
After this taxonomic revision, G. lichtenfelderi sensu stricto is restricted to the Asian mainland. It is known from Quang Ninh, Bac Giang, Hai Duong, and Hanoi (Ba Vi) in northern Vietnam, as well as from Fangchenggang and Chongzuo in Guangxi Zhuang Autonomous Region, China (
20 ♂♂, 18 ♀♀ from China, see Appendix 1 for detail.
Based on this study: (1) SVL 80.1–97.0 mm in adult males, 73.3–97.5 mm in adult females; (2) external nares bordered by 9–11 nasal scales; (3) internasal 0–2, mostly single or two, rarely absent; (4) supralabials 8–11; (5) infralabials 6–9; (6) preorbital scales 14–21; (7) supraorbital region with a row of slightly enlarged tubercles; (8) eyelid fringe scales 50–63; (9) scales around midbody 89–113; (10) longitudinal dorsal tubercle rows at midbody 19–25; (11) paravertebral tubercles between limb insertions 18–24; (12) axillary pockets shallow or deep; (13) presence of 25–31 precloacal pores in males, form a continuous transverse series extending onto the femora; precloacal pores in females absent; (14) dorsal ground color of head, body and limbs dark purple-brown to almost black in juveniles without blotches; dorsal ground color of head, body and limbs purple to dark purple-brown in adults, with or without small irregularly shaped dark brown blotches; (15) presence of four transverse bands, including one nuchal loop, two body bands and one caudal constriction band, light yellow with black brown anterior and posterior borders; (16) nuchal loop mostly rounded posteriorly, rarely protracted; (17) iris orange to dark reddish-brown.
Goniurosaurus cf. lichtenfelderi is only known from Hainan Island, China. Its distribution extends southward from Haikou City, westward to Qiongzhong County, eastward to Wenchang City, and as far south as the southern foothills of the Wuzhishan Mountains, including Qixianling and Diaoluoshan, at elevations of 30–862 m (this study) (Fig.
Chresonymy.
Goniurosaurus bawanglingensis
—
周氏睑虎.
Zhou’s leopard gecko.
BL-RBZ-002, adult male, collected from a central area (ca 220–300 m a.s.l) of Hainan Island, China; exact locality withheld; collected by Run-Bang Zhou on 18 March 2017.
four paratypes in total, two adult males (BL-RBZ-001, 007) and two adult females (BL-RBZ-003, 008) share same information with holotype.
7 ♂♂, 10 ♀♀, see Appendix 1 for detail.
Based on the previous description (
Goniurosaurus zhoui is an endemic species on Hainan Island, which is currently known from Baisha Li Autonomous County (Nankai town and National Park of Hainan Tropical Rainforest, Yinggeling Area, formerly Yinggeling National Natural Reserve), Changjiang Li Autonomous County (Wangxia town), Dongfang City (National Park of Hainan Tropical Rainforest, Bawangling Area, formerly Exianling Provincial Natural Reserve) Hainan Province, China, at elevations of 200–390 m (
A questionable photographic record of “Goniurosaurus lichtenfelderi hainanensis” with the original figure legend: “Adult female from west of Wuzhishan (Five Finger Mountain), Hainan Island, Hainan Province, China. Photograph by Richard C. Goris. Note that the tip of the tail has been regenerated in this individual”, cited from
The geological history of Hainan Island has played a pivotal role in shaping regional biodiversity, yet the timing and process of its separation from the Asian continent remain controversial (
However, due to sampling gaps,
Over the past decades, the diversity of the genus Goniurosaurus has significantly increased with the use of molecular phylogenetics. However, some new species have been described based on only a few specimens from a single locality (
Our study resolves several long-standing taxonomic issues in the Goniurosaurus lichtenfelderi group and highlights the importance of comprehensive sampling and comparisons with topotypic material for understanding species boundaries. However, several questions remain unanswered and warrant further investigation. For instance, whether G. cf. lichtenfelderi on Hainan Island should be described as an independent species or treated as a geographic population of G. lichtenfelderi. In addition, the current distribution boundaries between G. hainanensis and G. cf. lichtenfelderi on Hainan Island remain unclear, as does whether they occur sympatrically in certain areas and whether a hybrid zone exists between them. Furthermore, the distribution patterns of different species across Hainan Island and adjacent mainland areas require further exploration by integrating phylogenetic, ecological, and biogeographic data. Addressing these questions will not only deepen our understanding of the evolutionary history of the G. lichtenfelderi group but also provide valuable insights for conservation planning and management.
We thank Jian Wang, Zhao-Chi Zeng, Hong-Hui Chen, Zhi-Tong Lyu, Shun Ma, Zhi-Fei Ma, Bo Cai, Huan-Qiang Chen, Xu-Ming Qi, and Shi-Li Wang for their assistance with fieldwork. We also thank Yong-Heng Zhu for his help during fieldwork and for providing photo of juvenile Goniurosaurus bawanglingensis; Tong-Liang Wang for assisting in the examination of Goniurosaurus specimens at Hainan Normal University and for providing photos of G. sinensis; Kai Wang for helping to examine the type specimen of G. bawanglingensis and for providing photos; and Yi-Bo Lin for providing photos of juvenile G. zhoui. We thank Stevie Kennedy-Gold and Cynthia Wang-Claypool for their assistance in obtaining photographs of the holotype of Goniurosaurus hainanensis. We are also grateful to the scientific editor and two anonymous reviewers for their valuable suggestions. This work was supported by DFGP Project of Fauna of Guangdong-202115, and the National Animal Collection Resource Center, China.
Specimens of the genus Goniurosaurus examined in this study.
Goniurosaurus bawanglingensis (15 ♂♂, 10 ♀♀). China: Hainan: National Park of Hainan Tropical Rainforest Bawangling Area:
Goniurosaurus hainanensis (11 ♂♂, 6 ♀♀). China: Hainan: Sanya City: Ganzaling Provincial Nature Reserve: HNNU 2018102902–HNNU 2018102905, HNNU 2018102907–HNNU 2018102909 (7 ♂♂), HNNU 2018102901, HNNU 2018102906, HNNU 2018102910 (3 ♀♀); National Park of Hainan Tropical Rainforest Maorui Area: HNNU 2020070301 (1 ♂); Wuzhishan City:
Goniurosaurus cf. lichtenfelderi (20 ♂♂, 18 ♀♀). China: Hainan: Wenchang City: Tongguling National Nature Reserve: HNNU 2018061001, HNNU 2017111301–HNNU 2017111303, HNNU 2017102101 (5 ♂♂), HNNU 2018061002–HNNU 2018061004 (3 ♀♀); Haikou City: HNNU 2018051802, HNNU 2018051804, HNNU 2018051807 (3 ♂♂), HNNU 2018051801, HNNU 2018051803, HNNU 2018051805, HNNU 2018051806, HNNU 2018051808–HNNU 2018051811 (8 ♀♀); Wanning City: Dazhou Island: HNNU 2020060601 (1 ♂); National Park of Hainan Tropical Rainforest Diaoluoshan Area: HNNU 2018041301 (1 ♂); HNNU 2018041302, HNNU R0433 (2 ♀♀); Baoting Li and Miao Autonomous County: Qixianling National Forest Park: HNNU 201710, HNNU 20171013019 (2 ♂♂); Qionghai City: HNNU qionghai02, HNNU 2018060303, HNNU 2018060304 (3 ♂♂), HNNU qionghai03, HNNU 2018060301, HNNU 2018060302 (3 ♀♀); Limushan Provincial Nature Reserve: HNNU 20181028, HNNU 2018102807–HNNU 2018102809, HNNU 2018102811 (5 ♂♂), HNNU 2018102802, HNNU 2018102806 (2 ♀♀).
Goniurosaurus zhoui (7 ♂♂, 10 ♀♀). China: Hainan: Baisha Li Autonomous County:
Tables S1–S3
Data type: .zip
Explanation notes: Table S1. The multiple factor analysisdataset [.xlsx-file]. — Table S2. Sample list of genus Goniurosaurus and outgroups for phylogenetic analysis in this study. All sequences beginning with “C_” represent GenBase accession numbers, whereas all other sequences correspond to GenBank accession numbers [.docx-file]. — Table S3. List of samples and genetic loci used in molecular dating analyses [.docx-file].