Print
An investigation into the taxonomy of Abavorana luctuosa (Peters, 1871) (Anura, Ranidae) and the resurrection of Rana decorata Mocquard, 1890 from Borneo
expand article infoEvan S. H. Quah§|, L. Lee Grismer§, Perry L. Wood Jr., Kelvin K. P. Lim|, Paul Y. Imbun#, M. S. Shahrul Anuar¤
‡ Universiti Malaysia Terengganu, Kuala Nerus, Malaysia
§ La Sierra University, Riverside, United States of America
| National University of Singapore, Singapore, Singapore
¶ Auburn University, Auburn, United States of America
# Sabah Parks, Sabah, Malaysia
¤ Universiti Sains Malaysia, Penang, Malaysia
Open Access

Abstract

The taxonomic status of the ranid frog Abavorana luctuosa (Peters, 1871) was investigated using a combination of molecular and morphological data. The analyses revealed that A. luctuosa sensu lato is composed of two species in Borneo. One of these species agrees with the description of Rana decorata Mocquard, 1890 which is resurrected in the combination Abavorana decorata comb. nov. (Mocquard, 1890). Abavorana decorata is recovered as the sister lineage to the remainder of Abavorana and differs by a 16.0–17.0 % uncorrected pairwise sequence divergence from its congeners A. nazgul and A. luctuosa, respectively. It is distinguishable morphologically from A. luctuosa and A. nazgul by its ventral pattern (bold, black and white reticulations on its venter along with bold banding on the underside of hind limbs vs. generally immaculate and spotted in the latter two species), and a prominent white streak beneath the eye and/or tympanum extending to the corner of the jaw. Abavorana decorata further differs from A. luctuosa by having a significantly wider head and snout, larger interorbital and tympanum diameters, longer femur in both sexes, and various combinations of other mensural characters. Both species are sympatric in Borneo and this discovery adds to a growing number of widespread Sundaic species shown to be species complexes with distinct forms in Borneo.

Key words

amphibia, biodiversity, conservation, endemic, herpetofauna, phylogeny, Sundaland, systematics

Introduction

The Mahogany frog (Abavorana luctuosa) is a colourful riparian species heard at night calling from tangled thickets along the edges of small streams and rivers as well as standing bodies of water such as ponds, pig wallows and pools in intermittent streams on the Thai-Malay Peninsula and Borneo. Abavorana luctuosa was described by Peters in 1871 from an unspecified location in Sarawak, East Malaysian Borneo (Capocaccia 1957). It was once thought to be a single wide-ranging species across Sundaland until a second species A. nazgul, was recently described from Gunung Jerai in Peninsular Malaysia (Quah et al. 2017). In their analyses, Quah et al. (2017) also recovered populations of A. luctuosa from Sabah as polyphyletic and only distantly related to one another.

Building upon these preliminary findings, we hypothesize that these populations are distinct evolutionary lineages and test this hypothesis with increased sample sizes from Borneo, Thailand, Peninsular Malaysia and detailed morphological, colour pattern, and genetic analyses based on the mitochondrial genes 16S, ND1 and flanking tRNAs (tRNA-Leu, tRNA-Ile, and tRNA-Gln). Given the results from the preponderance of data analyses herein, we rescind Boulenger’s synonymization of Rana decorata Mocquard, 1890 with Abavorana luctuosa and resurrect the species in the combination Abavorana decorata comb. nov. (Mocquard, 1890).

Materials and methods

DNA extraction and amplification

Nine additional specimens of Abavorana luctuosa sensu lato from Borneo were sequenced (Table 1). Genomic DNA was isolated from liver or skeletal muscle stored in 95% ethanol using a SPRI magnetic bead extraction protocol (https://github.com/phyletica/lab-protocols/blob/master/extraction-spri.md). A combined fragment (1443 bp) of the mitochondrial genes 16S, ND1 and flanking tRNAs (tRNA-Leu, tRNA-Ile, and tRNA-Gln) was amplified using a double stranded polymerase chain reaction (PCR) under the following conditions: 1.0 µl genomic DNA (10–30 µg), 1.0 µl (concentration 10 µM) light strand primer 16S-frog 5’ TTACCCTGGGGATAACAGCGCAA–3’ (Camargo et al. 2006), 1.0 µl (concentation 10µM) heavy strand primer tmet-frog 5’–TTGGGGTATGGGCCCAAAAGCT–3’ (Camargo et al. 2006), 1.0 µl dinucleotide pairs (1.5 µM), 2.0 µl 5x buffer (1.5 µM), 1.0 µl MgCl 10x buffer (1.5 µM), 0.1 µl Taq polymerase (5units/µl), and 6.4 µl ultra-pure H2O. All PCR reactions were carried out on an Axygen Maxygene II gradient thermocycler under the following thermal profile: initial denaturation at 94°C for 2 min 30s, followed by 30 cycles of a secondary denaturation at 94°C for 1 min, annealing at 54°C for 1 min, elongation at 72°C for 1.5 min. PCR products were visualized via a 1.0% agarose gel electrophoresis. Successful PCR products were sent to GENEWIZ® for PCR purification, cycle sequencing, sequencing purification, and sequencing using the same primers as in the amplification. Sequences were analysed from both the 3’ and the 5’ ends separately to confirm congruence between reads. All forward and reverse sequences were uploaded and edited in Geneious™ version v11 (Kearse et al. 2012). Following sequence editing, 16S, ND1 and flanking tRNAs were aligned using the MAFTT v7.017 (Katoh et al. 2002) plugin under the default settings in Geneious™ (Kearse et al. 2012). Sequences were checked in Mesquite v3.5 (Maddison & Maddison, 2019) to ensure the correct amino acid reading frame for the coding region ND1.

Table 1.

Specimens used for the molecular phylogenetic analyses.

Taxon Locality Voucher GenBank no. Reference
Outgroups
Meristogenys stenocephalus Borneo, Sabah, Crocker Range National Park UMS:BORNEENSIS 8684 AB526612.1 Shimada et al. 2011
Pulchrana sundabarat West Malaysia, Kelantan, Pergau USMHC 1468 KY982540 Quah et al. 2017
Ingroup
Abavorana decorata Borneo, Sabah, Lahad Datu district, Danum Valley FMNH 231052 KY982535 Quah et al. 2017
Abavorana nazgul West Malaysia, Kedah, Gunung Jerai LSUHC 10512 KY982537 Quah et al. 2017
Abavorana nazgul West Malaysia, Kedah, Gunung Jerai LSUHC 10513 KY982538 Quah et al. 2017
Abavorana nazgul West Malaysia, Kedah, Gunung Jerai LSUHC 10514 KY982539 Quah et al. 2017
Abavorana luctuosa Borneo, Sabah, Sipitang district, Mendolong FMNH 234972 KY982536 Quah et al. 2017
Abavorana luctuosa Borneo, Sabah, Sipitang district, Mendolong FMNH 235295 MW478376 This study
Abavorana luctuosa Borneo, Sabah, Sipitang district, Mendolong FMNH 238720 MW478379 This study
Abavorana luctuosa Borneo, Sarawak, Bintulu division, Tubau Camp FMNH 269008 MW478378 This study
Abavorana luctuosa Borneo, Sarawak, Bintulu division, Tubau Camp FMNH 269142 MW478383 This study
Abavorana luctuosa Borneo, Sarawak, Bintulu division, Tubau Camp FMNH 269143 MW478380 This study
Abavorana luctuosa Borneo, Sarawak, Bintulu division, Bukit Kana FMNH 273216 MW478384 This study
Abavorana luctuosa Borneo, Sarawak, Bintulu division, Bukit Kana FMNH 273217 MW478377 This study
Abavorana luctuosa Borneo, Sarawak, Bintulu division, Bukit Kana FMNH 273218 MW478381 This study
Abavorana luctuosa Borneo, Sarawak, Bintulu division, Samarakan FMNH 273220 MW478382 This study
Abavorana luctuosa West Malaysia, Kelantan, Gunung Stong LSUHC 11087 KY982519 Quah et al. 2017
Abavorana luctuosa West Malaysia, Kedah, Sungai Sedim LSUHC 9731 KY982520 Quah et al. 2017
Abavorana luctuosa West Malaysia, Penang, Penang Hill USMHC 1649 KY982521 Quah et al. 2017
Abavorana luctuosa West Malaysia, Penang, Penang Hill USMHC 1650 KY982522 Quah et al. 2017
Abavorana luctuosa West Malaysia, Penang, Penang Hill USMHC 1651 KY982523 Quah et al. 2017
Abavorana luctuosa West Malaysia, Penang, Penang Hill USMHC 1652 KY982524 Quah et al. 2017
Abavorana luctuosa West Malaysia, Selangor, Gombak LSUHC 6580 KY982525 Quah et al. 2017
Abavorana luctuosa West Malaysia, Selangor, Gombak LSUHC 6585 KY982526 Quah et al. 2017
Abavorana luctuosa West Malaysia, Pahang, Fraser’s Hill LSUHC 12679 KY982527 Quah et al. 2017
Abavorana luctuosa West Malaysia, Pahang, Fraser’s Hill LSUHC 12680 KY982528 Quah et al. 2017
Abavorana luctuosa West Malaysia, Pahang, Fraser’s Hill LSUHC 12681 KY982529 Quah et al. 2017
Abavorana luctuosa West Malaysia, Pahang, Genting Highlands LSUHC 11663 KY982530 Quah et al. 2017
Abavorana luctuosa West Malaysia, Pahang, Genting Highlands LSUHC 11664 KY982531 Quah et al. 2017
Abavorana luctuosa West Malaysia, Pahang, Genting Highlands LSUHC 11665 KY982532 Quah et al. 2017
Abavorana luctuosa West Malaysia, Pahang, Genting Highlands LSUHC 11666 KY982533 Quah et al. 2017
Abavorana luctuosa West Malaysia, Pahang, Genting Highlands USMHC 1662 KY982534 Quah et al. 2017

Phylogenetic analysis

The new sequences were added to the molecular phylogenetic dataset of Quah et al. (2017) along with additional GenBank sequences from Shimada et al. (2011) (Table 1). Ingroup samples consisted of 30 individuals representing three nominal species of Abavorana (Table 1). Outgroups species used to root the tree were Pulchrana sundabarat Chan, Abraham, Grismer & Brown, and Meristogenys stenocephalus Shimada, Matsui, Yambun & Sudin, based in part on the relationships of Quah et al. (2017). New sequence data generated for this study are deposited on GenBank (Table 1).

Maximum likelihood (ML) and Bayesian Inference (BI) were used to generate phylogenetic trees. The data were partitioned into four partitions (ND1 by codon positions [1–3] and 16S+tRNAs) and best-fit models of evolution were determined in the IQ-TREE webserver version (Nguyen et al. 2015; Trifinopoulos et al. 2016) using the Bayesian information criterion (BIC; Schwarz 1978) implemented in ModelFinder (Kalyaanamoorthy et al. 2017). The model K2P+G4 was the best-fit model of evolution for ND1 codon position 1, HKY+I for codon position 2, TN+I for codon position 3 and TIM2e+G4 for 16S+ tRNAs. The ML analysis was performed using the IQ-TREE webserver (Trifinopoulos et al. 2016) with 1000 bootstrap pseudoreplicates using the ultrafast bootstrap (UFBoot) option (Minh et al. 2013; Hoang et al. 2017). The Bayesian analysis was performed in BEAST v2.5.1 (Bouckaert et al. 2014) using bModelTest (Bouckaert & Drummond 2017) to numerically integrate over uncertainty in models of substitution, while estimating the phylogeny using Markov chain Monte Carlo (MCMC). The models selected by bModelTest for ND1 codon position 1 was 123141 (posterior support 35.22%), codon position 2, 121131 (posterior support 6.22%), codon position 3, 121131 (posterior support 29.94%) and 123454 (posterior support 29.01%) for the noncoding partition 16S+tRNAs. We ran the MCMC chain for 100 million generations while sampling every 10,000 generations. Stationarity was checked with Tracer v1.7 (Rambaut et al. 2018) and the effective sample sizes for all parameters were greater than 200. A maximum clade credibility tree was generated by summarizing the posterior distribution of trees after discarding the first 25%, using mean node heights with TreeAnnotator v2.5.1 (Bouckaert et al. 2014). We considered Bayesian posterior probabilities (BPP) of 0.95 and above and ultrafast bootstrap support values (UFBoot) of 95 and above as strong nodal support (Huelsenbeck et al. 2001; Minh et al. 2013). Uncorrected pairwise sequence divergences (p-distance) were calculated in MEGA v6.06 using default settings which used pairwise deletion for the treatment of gaps and missing data in the dataset (Tamura et al. 2013) (Table 2).

Table 2.

Uncorrected p-distances of the genus Abavorana. Mean (min–max) uncorrected p-distances (%) within examined populations of the genus Abavorana Oliver, Prendini, Kraus & Raxworthy 2015 computed in MEGA v6.06 (Tamura et al. 2013). Distances in bold are intraspecific distances, and distances below the diagonal are interspecific distances. n = number of individuals

n A. decorata A. nazgul A. luctuosa (Pen. Malaysia) A. luctuosa (Borneo)
A. decorata 1
A. nazgul 3 0.17 0.00
A. luctuosa (Pen. Malaysia) 16 0.16 0.08 0.00 (0.00–0.02)
A. luctuosa (Borneo) 10 0.16 (0.16–0.17) 0.08 (0.07–0.08) 0.02 (0.02–0.03) 0.01 (0.00–0.03)

Morphological analysis

Morphological data from 62 adult specimens (34 males; 28 females) of Abavorana luctuosa sensu lato from 21 populations throughout the Thai-Malay Peninsula and Borneo (Appendix 1), and eight specimens of A. nazgul (seven males; one female) from the type locality in Peninsular Malaysia, were taken following the methodology of Quah et al. (2017) (Table 3). Notes on colour pattern were taken from digital images of living and euthanized specimens prior to preservation. Sex was determined by the presence of the humeral glands in adult male Abavorana as they lack vocal sacs and nuptial pads (Inger 1966). The following characters were measured by ESHQ with a Control Company digimatic caliper to the nearest 0.01 mm on the right side of the body for symmetrical characters: snout-vent length (SVL), from the tip of snout to the vent; head length (HL), from the posterior margin of mandible to the tip of snout; head width (HW), measured at the level of the jaw articulation points; snout length (SL), from the anterior margins of eyes to the tip of snout; snout width (SW), distance between the anterior margins of eyes; interorbital diameter (IOD), distance across the top of the head between the medial margins of the upper eyelids at their closest points; internarial distance (IND), distance between the medial margins of the nostrils; eye diameter (ED), distance between the anterior and posterior margins of the eyeball; tympanum diameter (TD), the horizontal width of the tympanum at its widest point; brachium length (BL), distance from the axilla to most distal point of inflection on flexed elbow; forearm length (FAL), distance from outer margin of flexed elbow to the base of the inner metacarpal tubercle; manus length (ML), distance from the proximal edge of the outer metacarpal tubercle to the tip of the third finger; femur length (FL), distance from the vent to the outer margin of the flexed knee; crus length (CL), distance from the outer face of flexed knee to the outer margin of tarsal inflection; tarsal length (TL), the outer margin of flexed tarsus to the base of the inner metatarsal tubercle; pes length (PL), measured from the proximal edge of the inner metatarsal tubercle to the tip of fourth toe; humeral gland length (HG), the horizontal length of the humeral gland. Discrete colour pattern data, along with univariate and multivariate analyses of morphological data (see statistical analyses below) were then used to search for characters and morphospatial patterns bearing statistically significant differences that were consistent with the previous designations of the species-level hypotheses, thus providing independent diagnoses to complement the molecular analyses.

Table 3.

Measurements of Abavorana decorata, A. nazgul and different populations of A. luctuosa. Abbreviations are listed in the Materials and methods.

Catalog no. Species SVL HL HW SL SW IOD IND ED TD BL FAL ML FL CL TL PL HG
ZRC 1.709 A. decorata 58.42 23.71 20.87 8.52 10.87 6.60 6.67 5.72 5.27 9.00 11.68 13.12 30.42 30.93 13.4 27.92
SP02100 A. decorata 29.66 12.23 10.62 4.69 6.25 3.91 3.68 4.04 2.27 6.81 5.79 8.36 17.19 17.28 8.52 14.72
SP02810 A. decorata 57.67 22.05 20.03 9.46 10.98 6.78 6.72 6.17 5.36 10.35 13.94 14.95 29.74 32.00 15.84 30.45
SP20695 A. decorata 57.92 22.76 21.07 9.31 11.68 6.05 6.77 6.58 5.63 10.27 12.71 14.79 31.34 32.50 16.00 31.49
SP26873 A. decorata 46.21 19.14 17.66 7.76 9.91 5.95 6.16 5.56 4.54 8.51 10.77 12.2 25.58 24.74 13.13 23.44 3.25
FMNH 109935 A. decorata 55.00 19.05 18.57 7.99 10.36 6.12 6.21 5.42 4.46 9.53 11.47 14.00 25.81 29.83 14.98 27.50
FMNH 109936 A. decorata 56.00 19.05 19.53 8.22 10.71 5.39 6.09 5.93 4.6 10.06 11.18 15.00 26.1 29.33 14.98 28.00 3.89
FMNH 231052 A. decorata 33.69 13.9 11.92 6.42 7.07 4.29 4.48 3.94 2.78 6.89 6.59 9.33 17.25 17.74 9.19 17.12
USMHC 2231 A. nazgul 43.99 17.14 15.83 7.44 8.70 4.48 5.54 3.86 3.80 8.87 8.13 11.00 23.11 24.01 11.84 24.08 2.51
USMHC 2232 A. nazgul 41.56 16.56 14.88 7.10 8.04 4.47 5.76 4.15 3.52 8.34 8.07 11.08 23.08 23.77 11.70 23.40 2.76
USMHC 2233 A. nazgul 44.10 16.68 14.72 7.16 8.02 3.99 5.45 4.06 3.61 8.76 8.29 11.05 22.56 23.85 11.30 22.76 2.41
LSUHC 10512 A. nazgul 41.51 16.50 14.63 7.13 8.11 4.33 5.80 3.93 3.60 8.49 7.54 10.37 22.31 22.83 10.70 22.1 2.4
LSUHC 10513 A. nazgul 42.70 16.50 15.03 7.25 8.39 4.12 5.73 4.24 3.58 8.48 7.84 10.90 22.20 23.52 11.14 23.18 2.47
LSUHC 10514 A. nazgul 52.51 19.65 18.57 8.69 9.59 4.94 6.61 4.80 4.10 12.02 10.17 13.41 27.80 28.77 14.42 28.84
USMHC 2572 A. nazgul 43.92 16.36 15.60 7.54 8.60 4.05 5.56 4.36 4.01 8.98 8.23 11.53 23.22 23.93 11.31 24.46 2.55
USMHC 2573 A. nazgul 41.61 16.52 15.41 7.57 7.98 3.94 5.67 4.56 3.91 8.32 8.39 11.25 22.43 23.26 10.95 23.22 2.98
FMNH 135347 A. luctuosa Malay Peninsula 44.39 15.20 13.83 6.48 8.75 4.81 6.41 5.05 3.24 9.49 9.23 11.24 21.92 24.69 12.39 22.52
USMHC 2576 A. luctuosa Malay Peninsula 46.12 16.84 14.66 7.80 9.19 4.12 5.42 5.04 3.90 9.91 9.20 12.42 23.95 24.94 12.44 25.38
USMHC 2577 A. luctuosa Malay Peninsula 44.17 16.69 15.58 7.56 8.62 4.59 5.44 4.60 3.32 7.99 7.90 10.58 19.82 21.59 11.61 21.72 3.40
USMHC 2310 A. luctuosa Malay Peninsula 41.27 16.37 14.50 6.99 8.52 4.33 5.27 4.10 3.54 7.80 7.66 10.25 21.27 22.03 11.02 22.03 3.36
LSUHC 9731 A. luctuosa Malay Peninsula 37.20 14.70 13.39 6.75 8.21 4.03 5.08 3.80 3.41 8.03 8.14 10.46 19.80 22.14 10.92 20.50 3.89
LSUHC 11087 A. luctuosa Malay Peninsula 48.7 19.59 15.98 8.29 9.38 4.93 6.72 4.75 3.82 9.11 9.64 13.72 25.14 27.29 14.30 27.32
ZRC 1.11129 A. luctuosa Malay Peninsula 49.75 19.35 16.84 8.07 8.37 5.20 6.04 5.21 3.96 7.67 9.38 12.50 24.52 26.48 14.56 26.30
ZRC 1.3145 A. luctuosa Malay Peninsula 43.89 17.96 15.12 7.47 8.29 3.80 5.75 4.38 3.58 6.69 8.87 11.23 21.55 25.72 12.74 23.5
LSUHC 13479 A. luctuosa Malay Peninsula 51.06 19.15 16.17 8.24 9.25 5.49 6.53 5.19 4.24 9.37 11.39 12.55 26.37 28.75 14.52 27.86
LSUHC 13486 A. luctuosa Malay Peninsula 45.71 17.09 16.32 7.64 9.04 4.92 5.90 4.40 4.14 7.80 9.84 10.01 21.91 23.88 12.36 22.55
LSUHC 13487 A. luctuosa Malay Peninsula 43.06 15.85 14.58 6.95 8.18 5.14 5.70 4.20 3.66 7.08 8.55 9.83 20.78 23.49 12.26 22.55 4.41
LSUHC 13488 A. luctuosa Malay Peninsula 49.50 18.05 16.76 8.30 8.97 5.64 5.87 4.97 3.93 8.48 11.07 11.60 23.72 26.39 13.14 25.46
LSUHC 13535 A. luctuosa Malay Peninsula 49.13 18.43 16.57 8.14 8.99 5.13 6.17 5.01 4.07 8.70 10.00 12.29 25.00 27.03 13.49 26.05
LSUHC 13549 A. luctuosa Malay Peninsula 46.08 16.08 14.74 7.37 8.21 5.15 5.73 4.65 3.79 8.57 8.96 10.92 23.67 24.95 12.25 25.15
LSUHC 13550 A. luctuosa Malay Peninsula 44.27 16.41 14.45 7.17 8.16 4.38 5.48 4.07 3.59 7.43 7.73 11.13 22.04 23.73 12.35 23.11 3.80
USMHC 2574 A. luctuosa Malay Peninsula 46.89 17.23 16.48 8.19 8.82 5.06 6.13 4.91 3.87 8.6 9.10 12.75 24.4 25.18 12.79 25.14
USMHC 2575 A. luctuosa Malay Peninsula 40.56 16.26 14.34 7.43 8.12 4.59 5.14 4.70 3.41 7.37 8.81 10.69 21.91 22.36 11.30 22.00 2.58
FMNH 141734 A. luctuosa Malay Peninsula 40.17 14.45 13.78 6.62 7.58 3.25 5.30 4.15 2.62 8.85 8.27 10.34 18.62 21.43 10.72 20.83 2.81
FMNH 141735 A. luctuosa Malay Peninsula 38.09 14.96 14.51 6.43 8.04 4.11 5.07 4.31 3.24 8.84 8.30 10.54 20.54 21.28 10.66 19.62 3.50
FMNH 141736 A. luctuosa Malay Peninsula 40.77 15.75 13.94 6.70 8.26 4.21 5.88 4.38 3.12 8.14 8.01 9.65 19.58 20.75 10.00 20.58 3.09
FMNH 141738 A. luctuosa Malay Peninsula 37.83 14.94 13.35 6.20 7.11 4.89 4.93 4.17 3.05 8.34 7.55 9.68 18.38 21.03 10.31 20.59 3.09
ZRC 1.11943 A. luctuosa Borneo 37.78 15.92 13.49 6.33 7.52 3.80 4.66 4.09 3.00 5.78 7.98 8.69 17.82 19.70 10.69 18.40 3.87
ZRC 1.11938 A. luctuosa Borneo 43.58 17.60 14.96 7.30 7.71 4.70 5.10 4.33 3.77 7.38 9.55 10.33 20.10 23.72 12.82 21.97
ZRC 1.2270 A. luctuosa Borneo 42.71 16.51 14.67 6.97 8.06 4.90 4.75 4.82 3.38 8.14 9.32 10.10 21.44 22.63 11.69 21.16
FMNH 234985 (SP00897) A. luctuosa Borneo 37.43 15.75 13.69 6.54 7.83 4.56 5.03 4.00 2.81 6.93 7.83 8.69 18.99 20.83 11.05 19.96 4.05
FMNH 242884 (SP01905) A. luctuosa Borneo 45.19 16.26 15.74 6.99 9.02 5.60 5.99 4.79 3.63 8.47 9.89 11.29 23.09 24.98 13.48 23.73
SP02676 A. luctuosa Borneo 39.83 15.78 13.73 6.64 7.94 4.63 5.32 4.50 3.61 6.68 8.92 9.94 21.31 21.94 11.22 19.69 3.65
FMNH 234972 A. luctuosa Borneo 39.51 15.26 13.58 6.90 7.95 4.70 5.58 4.59 3.40 7.86 8.01 10.59 21.25 22.06 11.75 20.88 3.96
FMNH 234973 A. luctuosa Borneo 37.22 13.53 13.27 6.09 7.59 3.83 4.76 3.65 3.35 7.20 7.50 9.20 19.04 19.53 9.86 19.01 3.06
FMNH 234974 A. luctuosa Borneo 37.05 14.84 12.71 6.61 7.65 4.15 5.01 4.08 2.95 8.87 8.50 9.22 19.13 21.63 11.29 21.29
FMNH 234975 A. luctuosa Borneo 38.86 15.15 13.64 6.67 7.69 3.78 5.26 4.33 3.11 8.56 7.22 10.10 19.81 20.72 10.28 20.32 3.92
FMNH 234976 A. luctuosa Borneo 36.30 14.16 13.17 5.66 7.33 4.13 4.89 3.98 2.50 7.37 7.25 9.49 18.31 20.11 10.19 19.53 3.12
FMNH 234977 A. luctuosa Borneo 35.41 14.72 12.92 6.35 7.77 4.22 5.04 4.18 2.75 7.38 7.77 8.73 19.13 20.29 10.71 19.21 3.95
FMNH 234978 A. luctuosa Borneo 35.05 14.25 12.28 6.39 7.47 4.10 5.41 4.20 3.26 8.65 7.36 8.79 18.53 20.82 10.39 20.55 2.50
FMNH 234979 A. luctuosa Borneo 36.78 14.54 12.25 6.26 7.57 4.10 5.01 4.30 3.05 8.92 7.23 9.03 17.81 21.22 10.84 20.09 2.22
FMNH 234980 A. luctuosa Borneo 38.19 14.44 13.39 6.01 7.57 4.00 4.90 4.40 3.34 8.53 7.51 9.36 19.43 20.91 11.27 20.50 3.85
FMNH 234981 A. luctuosa Borneo 38.22 15.27 12.90 6.50 7.65 4.59 5.05 4.12 3.07 8.96 7.13 9.47 19.32 20.93 10.86 21.28 3.79
FMNH 234982 A. luctuosa Borneo 39.74 15.98 13.93 6.75 7.84 4.62 5.44 4.54 3.04 9.06 8.13 9.55 20.63 21.39 11.36 20.87 3.58
FMNH 234983 A. luctuosa Borneo 37.27 15.51 13.25 6.96 7.90 4.53 5.50 3.79 3.06 8.42 7.42 9.13 19.86 21.5 11.55 20.93 3.22
FMNH 234984 A. luctuosa Borneo 38.37 15.04 12.80 6.62 8.22 4.41 5.28 4.05 3.00 8.94 7.27 9.43 20.12 21.23 11.27 21.82 4.16
FMNH 238720 A. luctuosa Borneo 39.01 15.74 13.65 6.63 8.02 4.19 5.38 3.95 3.16 9.05 7.49 9.03 20.98 21.36 10.97 20.96 3.33
FMNH 242882 A. luctuosa Borneo 45.01 17.49 15.52 7.40 8.79 4.86 5.80 5.22 3.67 10.2 9.92 10.61 23.68 24.27 13.11 22.82
FMNH 242883 A. luctuosa Borneo 45.2 17.45 14.85 7.00 8.72 4.72 5.77 4.81 3.41 9.95 8.82 10.91 22.66 24.64 12.83 23.25
FMNH 242885 A. luctuosa Borneo 43.75 17.06 14.51 7.34 8.71 4.65 5.74 4.54 3.47 10.13 9.01 11.08 22.17 22.99 12.71 23.01
FMNH 242886 A. luctuosa Borneo 45.11 17.57 15.14 7.13 8.81 4.55 5.98 4.74 3.64 10.29 8.25 11.29 22.55 25.02 12.69 23.69
FMNH 269008 A. luctuosa Borneo 42.18 17.72 13.92 6.93 7.75 4.58 5.31 4.75 3.18 8.11 9.11 10.65 21.05 19.83 11.71 22.00
FMNH 269142 A. luctuosa Borneo 38.46 15.62 13.41 6.98 7.40 4.28 5.20 3.73 2.88 6.85 8.01 11.00 19.78 20.99 11.22 20.34 2.18
FMNH 269143 A. luctuosa Borneo 39.18 16.08 13.97 6.69 8.00 4.14 5.33 4.39 3.24 9.37 8.52 10.39 21.57 21.42 11.18 21.71 2.29
FMNH 269144 A. luctuosa Borneo 39.56 16.78 13.44 7.03 7.72 3.80 5.23 4.23 3.83 9.56 7.56 10.40 20.58 20.68 10.40 19.45 2.67
FMNH 273216 A. luctuosa Borneo 39.32 15.06 13.72 6.76 7.66 4.59 4.95 4.35 3.40 7.68 8.03 10.36 20.48 21.24 10.48 20.44 2.46
FMNH 273217 A. luctuosa Borneo 44.93 15.81 15.09 7.86 8.04 4.62 5.37 4.81 3.18 8.81 8.25 11.78 21.66 23.15 12.30 23.32
FMNH 273218 A. luctuosa Borneo 40.87 17.33 14.49 7.36 8.41 4.31 5.70 4.67 3.59 10.00 8.23 11.36 21.55 22.37 11.21 22.53
FMNH 273219 A. luctuosa Borneo 37.25 14.80 13.60 6.62 7.53 4.25 5.10 4.30 3.19 7.97 7.45 10.22 19.28 19.5 10.17 19.49 3.14
FMNH 273220 A. luctuosa Borneo 40.55 16.12 14.41 6.79 7.90 3.95 5.13 4.28 3.38 9.45 8.22 10.79 19.9 20.95 10.8 20.82 2.73

Repositories, Institutional acronyms or Institutional abbreviations

Museum abbreviations are: FMNH (Field Museum of Natural History, Chicago, Illinois); LSUHC (La Sierra University Herpetological Collection, Riverside, California); MNHN (Muséum National d’Histoire Naturelle, Paris); MSNG (Museo Civico di Storia Naturale “Giacomo Doria”, Genova); SP (Sabah Parks Collection, Sabah, Malaysia); USMHC (Universiti Sains Malaysia Herpetological Collection); and ZRC (Zoological Reference Collection, Lee Kong Chian Natural History Museum [LKCNHM], Singapore).

Statistical analyses

All analyses were performed using the platform R version 3.2.1 (R Core Team 2015). Owing to a lack of genetic material from the type locality of Rana decorata at Mount Kinabalu, Sabah, an a priori decision as to the membership to which species to assign specimens prior to additional downstream analyses was based on the colour pattern of their venters which has been shown to be a distinguishing characteristic for the genus (Fig. 9; Quah et al. 2017). Specimens with bold black and white reticulations along flanks, and banding on the underside of their legs are identified as the decorata pattern morph, while those with generally immaculate venters are identified as the luctuosa pattern morph. To reduce allometric bias as a result of ontogeny, the characters of each species were scaled using the following equation: Xadj = log(X)-β[log(SVL)-log(SVLmean)], where Xadj = adjusted value; X = measured value; β = unstandardized regression coefficient for each population; SVL = measured snout-vent length; SVLmean = overall average SVL of all samples (Thorpe, 1983; Lleonart et al. 2000). Each species was scaled separately and the data concatenated so as not to conflate interpopulational variation. The measurements for the sexes were analysed separately to eliminate bias caused by sexual dimorphism. All raw measurements are presented in Table 3.

A MANOVA analysis was performed to test for significantly different (p < 0.05) multivariate structure in the mensural data and subsequently viewed in a principal component analysis (PCA). PCA and discriminant analysis of principal components (DAPC) were performed using the ADEGENET package in R (Jombart et al. 2010) to determine if the morphospatial position of Bornean Abavorana luctuosa populations with boldly marked venters and other populations of A. luctuosa with generally immaculate venters from Borneo and the Thai-Malay Peninsula coincided with the putative species boundaries delimited by the molecular phylogenetic analyses. All mensural data were incorporated in the analyses except HG which is absent in females. Principal components of the DAPC with eigenvalues accounting for 90–99% of the variation in the data were retained for the DAPC according to the criterion of Jombart et al. (2010). For this analysis, the first seven PCs out of 17 (males) and 16 (females) were retained which accounted for 94.9% (males) and 97.6% (females) of the variation.

Independent of the MANOVA, an analysis of variance (ANOVA) was conducted on mensural characters. Since the species and population sample sizes were unequal, a Levene’s test for homogeneity of variances among the mensural characters was conducted prior to an analysis of variance (ANOVA). A Welch’s ANOVA was conducted on characters with unequal variances (p ≥ 0.05) and a standard ANOVA was conducted on characters with equal variances (p ≤ 0.05) to test for the presence of statistically significant mean differences (p ≤ 0.05) between all combinations of species or population pairs in the data set. Characters with equal variances and bearing statistical differences were subjected to a TukeyHSD test to ascertain which population pairs differed significantly from each other for those characters (Table 4). Characters with unequal variances bearing statistical differences were subjected to a Games-Howell test to ascertain which population pairs differed significantly from each other for those characters (Table 4). Summary statistics were generated for the mensural data (Table 5).

Table 4.

Pairwise matrix of statistically significant characters among species of the genus Abavorana. Pairwise matrix of statistically significant mean differences of characters among Abavorana decorata, A. nazgul, and A. luctuosa populations from the Malay Peninsula and Borneo. Abbreviations are in the Materials and methods.

A. decorata A. nazgul A. luctuosa Malay Peninsula A. luctuosa Borneo
A. decorata
A. nazgul HL, HW, SL, IOD, ED, TD, FAL, TL, PL, SW, IND, ML, CL, FL, HG
HW, IOD, IND, FL, PL, SL, BL
A. luctuosa Malay Peninsula HL, HW, SL, IOD, ED, TD, FAL, TL, PL, SW, IND, ML, FL, CL HL, HW, SL, TD, PL, IND, ML, FL, CL, HG
HW, SW, IOD, TD, FL HL, HW, SW, ML, FL, CL, PL, SL, BL, TL
A. luctuosa Borneo HL, HW, SL, IOD, ED, TD, TL, PL, SW, IND, FAL, ML, CL, FL SVL, HL, HW, SL, TD, PL, SW, IND, ML, FL, CL, HG SVL, HW, SL, PL, ML, CL
HW, HL, SW, IOD, TD, FAL, ML, FL, CL, PL, ED HL, HW, SW, IND, TD, FAL, ML, FL, CL, PL, SL, BL, TL HW, SW, IND, TD, FAL, ML, FL, CL, PL, SL, TL
Table 5.

Summary statistics and ventral colour pattern among members of the genus Abavorana. Summary statistics and ventral colour pattern for Abavorana decorata, A. nazgul, and A. luctuosa populations from the Malay Peninsula and Borneo, SD = standard deviation, N = sample size, / = no data. Humeral gland only present in males and all measurements in mm.

A. decorata A. nazgul A. luctuosa Malay Peninsula A. luctuosa Borneo
Sex Male Female Male Female Male Female Male Female
N 2 6 7 1 10 11 22 11
Snout-vent length (SVL)
mean (±SD) 51.11 (±6.92) 48.73 (±13.32) 42.77 (±1.22) 52.51 40.74 (±2.54) 47.38 (±2.36) 38.15 (±1.45) 43.23 (±2.51)
range 46.21–56.00 29.66–58.42 41.51–44.10 / 37.20–44.27 43.89–51.06 35.05–40.55 37.05–45.20
Head length (HL)
mean (±SD) 19.10 (±0.06) 18.95 (±4.85) 16.61 (±0.25) 19.65 15.64 (±0.81) 17.72 (±1.39) 15.25 (±0.78) 16.88 (±0.92)
range 19.05–19.14 12.23–23.71 16.36–17.14 / 14.45–16.69 15.20–19.59 13.53–16.78 14.84–17.72
Head width (HW)
mean (±SD) 18.60 (±1.32) 17.18 (±4.68) 15.16 (±0.46) 18.57 14.24 (±0.66) 15.77 (±1.01) 13.39 (±0.52) 14.69 (±0.83)
range 17.66–19.53 10.62–21.07 14.63–15.83 / 13.35–15.58 13.83–16.84 12.25–14.41 12.71–15.74
Snout length (SL)
mean (±SD) 7.99 (±0.33) 7.73 (±1.85) 7.31 (±0.20) 8.69 6.88 (±0.43) 7.82 (±0.56) 6.55 (±0.34) 7.17 (±0.33)
range 7.76–8.22 4.69–9.46 7.10–7.57 / 6.20–7.56 6.48–8.30 5.66–7.03 6.61–7.86
Snout width (SW)
mean (±SD) 10.31 (±0.57) 9.54 (±2.28) 8.26 (±0.30) 9.59 8.08 (±0.44) 8.84 (±0.40) 7.73 (±0.23) 8.33 (±0.51)
range 9.91–10.71 6.25–11.68 7.98–8.70 / 7.11–8.62 8.21–9.38 7.33–8.22 7.65–9.02
Inter orbital distance (IOD)
mean (±SD) 5.67 (±0.40) 5.63 (±1.22) 4.20 (±0.23) 4.94 4.35 (±0.52) 4.93 (±0.54) 4.24 (±0.30) 4.69 (±0.37)
range 5.59–5.95 3.91–6.78 3.94–4.48 / 3.25–5.14 3.80–5.64 3.78–4.70 4.15–5.60
Internarial distance (IND)
mean (±SD) 6.13 (±0.05) 5.76 (±1.34) 5.64 (±0.13) 6.61 5.33 (±0.30) 6.06 (±0.38) 5.16 (±0.24) 5.50 (±0.42)
range 6.09–6.16 3.68–6.77 5.45–5.80 / 4.93–5.88 5.42–6.72 4.66–5.58 4.75–5.99
Eye diameter (ED)
mean (±SD) 5.75 (±0.26) 5.31 (±1.10) 4.17 (±0.24) 4.80 4.25 (±0.26) 4.87 (±0.29) 4.18 (±0.26) 4.69 (±0.29)
range 5.56–5.93 3.94–6.58 3.86–4.56 / 3.80–4.70 4.38–5.21 3.65–4.59 4.08–5.22
Tympanum diameter (TD)
mean (±SD) 4.57 (±0.04) 4.30 (±1.43) 3.72 (±0.19) 4.10 3.30 (±0.31) 3.87 (±0.27) 3.16 (±0.29) 3.44 (±0.25)
range 4.54–4.60 2.27–5.63 3.52–4.01 / 2.62–3.66 3.24–4.24 2.50–3.83 2.95–3.77
Brachium length (BL)
mean (±SD) 9.29 (±1.10) 8.81 (±1.60) 8.61 (±0.26) 12.02 7.99 (±0.59) 8.58 (±0.92) 8.14 (±1.04) 9.12 (±1.03)
range 8.51–10.06 6.81–10.35 8.32–8.98 / 7.08–8.85 6.69–9.91 5.78–9.56 7.38–10.29
Forearm length (FAL)
mean (±SD) 10.98 (±0.29) 10.36 (±3.36) 8.07 (±0.29) 10.17 8.09 (±0.40) 9.70 (±0.84) 7.72 (±0.47) 8.99 (±0.64)
range 10.77–11.18 5.79–13.94 7.54–8.39 / 7.55–8.81 8.87–11.39 7.13–8.92 8.23–9.92
Manus length (ML)
mean (±SD) 13.60 (±1.98) 12.43 (±2.86) 11.03 (±0.35) 13.41 10.32 (±0.48) 11.93 (±1.04) 9.67 (±0.72) 10.78 (±0.71)
range 12.20–15.00 8.36–14.95 10.37–11.53 / 9.65–11.13 10.01–13.72 8.69–11.0 9.22–11.78
Femur length (FL)
mean (±SD) 25.84 (±0.37) 25.29 (±6.53) 22.70 (±0.42) 27.80 20.27 (±1.26) 23.83 (±1.51) 19.72 (±1.08) 21.73 (±1.32)
range 25.58–26.10 17.19–31.34 22.2–23.22 / 18.38–22.04 21.55–26.37 17.81–21.57 19.13–23.68
Crus length (CL)
mean (±SD) 27.04 (±3.25) 26.71 (±7.19) 23.60 (±0.42) 28.77 21.98 (±0.99) 25.94 (±1.41) 20.88 (±0.70) 23.20 (±1.58)
range 24.74–29.33 17.28–32.50 22.83–41.01 / 20.75–23.73 23.88–28.75 19.50–22.06 19.83–25.02
Tarsal length (TL)
mean (±SD) 14.06 (±1.31) 12.99 (±3.34) 11.28 (±0.40) 14.42 11.12 (±0.78) 13.18 (±0.90) 10.84 (±0.50) 12.35 (±0.76)
range 13.13–14.98 8.52–16.00 10.70–11.84 / 10.00–12.35 12.25–14.56 9.86–11.75 11.21–13.48
Pes length (PL)
mean (±SD) 25.72 (±3.22) 24.87 (±7.13) 23.31 (±0.79) 28.84 21.35 (±1.09) 25.20 (±1.75) 20.28 (±0.88) 22.62 (±0.90)
range 23.44–28.00 14.72–31.49 22.10–24.46 / 19.62–23.11 22.52–27.86 18.40–21.82 21.16–23.73
Humeral gland (HG)
mean (±SD) 3.57 (±0.45) / 2.58 (±0.21) / 3.39 (±0.54) / 3.26 (±0.66) /
range 3.25–3.89 / 2.40–2.98 / 2.58–4.41 / 2.18–4.16 /
Pattern of venter Belly usually mottled with black and white reticulations along the flanks; limbs with bold black and white bands or reticulations Spotted Immaculate to very faint, sparse speckling Immaculate to very faint, sparse speckling

Results

Phylogeny and genetic divergence

The BI and ML analyses recovered trees with identical topologies. Specimen FMNH 231052 with bold black and white mottling on the ventral side of its flanks and banding on the underside of its legs from Danum Valley, Sabah (Fig. 6A & B) was recovered as the strongly supported (BPP=1.0, Ufboot=89) sister lineage of the remaining Abavorana (Fig. 1). The remaining A. luctuosa sensu lato from the Thai-Malay Peninsula and Borneo bearing generally immaculate venters and underside of their legs (Figs 1, 4) formed a strongly supported (BPP=1.0, Ufboot=96) clade, and were recovered as the sister species to A. nazgul (BPP=1.0, Ufboot=99). FMNH 231052 differs by an uncorrected pairwise sequence divergence of 16.0–17.0 % from A. nazgul and other A. luctuosa populations, respectively (Table 2). With the inclusion of additional Bornean specimens in this study, two reciprocally monophyletic lineages (BPP=1.0, Ufboot=96) of A. luctuosa with generally immaculate venters and underside of hind limbs were recovered—one from Peninsular Malaysia and another from Borneo (Fig. 1). Nevertheless, these populations differ from each other by only a 2.0–3.0 % uncorrected pairwise sequence divergence (Table 2).

Figure 1. 

Phylogenetic tree of the genus Abavorana; Maximum likelihood phylogram for species of the genus Abavorana. Nodal support is indicated by Bayesian posterior probability (BPP) / Ultrafast bootstrap (UFboot) respectively.

Morphometric and statistical analyses

The MANOVA indicated there were significant (Wilks’ lamda, p=2.2-16) differences in mensural data between both sexes of the two pattern morphs of Abavorana luctuosa sensu lato and A. nazgul, as visualized in the PCA and DAPC (Fig. 2). For males, the PCA and DAPC showed distinct separation between both the decorata and luctuosa pattern morph populations. In the PCA, the males of both phenotypes were clearly separated along PC1. PC1 accounts for 65.4% of the variation (Fig. 2), and loads most heavily for SVL, HW and CL (Appendix 2). In females, the PCA did not show a separation between the two pattern morphs as there was significant overlap along PC1 and PC2. However, the DAPC showed complete separation in the 66% confidence ellipses between the females of both phenotypes (Fig. 2). FMNH 231052 bearing the decorata pattern morph from Danum Valley, Sabah clustered in morphospace with topotypic material referable to Rana decorata from Mount Kinabalu, Sabah (FMNH 109935 and ZRC 1.709) in the DAPC. In both sexes, the luctuosa pattern morph populations from Borneo and the Thai-Malay Peninsula overlapped in both the PCA and DAPC analyses.

Figure 2. 

PCA and DAPC for the genus Abavorana; PCAs (left) with convex hull polygons and DAPCs (right) showing the morphospatial relationships of male (top) and female (bottom) Abavorana decorata, A. nazgul, and A. luctuosa populations from the Malay Peninsula and Borneo. 1 = FMNH 231052, 2 = ZRC 1.709 and 3 = FMNH 109935.

The analyses also revealed that both venter phenotypes also differ in a number of statistically significant mensural metrics (Table 4 & 5). Across both sexes, the two phenotypes differed significantly in their head width, snout width, interorbital diameter, tympanum diameter, and femur length. The specimens with the reticulated venters and boldly banded undersides of their legs (i.e. the decorata pattern morph) that match the descriptions of Rana decorata presented:

Significantly wider heads in both sexes, with HW of adult males 17.66–19.53 mm, mean 18.60 ± SD 1.32, n = 2 (vs. 12.25–14.41 mm, mean 13.39 ± SD 0.52, n = 22, P < 0.001, in Bornean Abavorana luctuosa, and 13.35–15.58 mm, mean 14.24 ± SD 0.66, n = 10, P < 0.001, in Malay Peninsula A. luctuosa) and adult females 10.62–21.07 mm, mean 17.18 ± SD 4.68, n = 6 (vs. 12.71–15.74 mm, mean 14.69 ± SD 0.83, n = 11, P < 0.001, in Bornean A. luctuosa, and 13.83–16.84 mm, mean 15.77 ± SD 1.01, n = 11, P < 0.01, in Malay Peninsula A. luctuosa); significantly wider snouts in both sexes, with SW of adult males 9.91–10.71 mm, mean 10.31 ± SD 0.57, n = 2 (vs. 7.33–8.22 mm, mean 7.73 ± SD 0.23, n = 22, P < 0.001, in Bornean A. luctuosa, and 7.11–8.62 mm, mean 8.08 ± SD 0.44, n = 10, P < 0.001, in Malay Peninsula A. luctuosa) and adult females 6.25–11.68 mm, mean 9.54 ± SD 2.28, n = 6 (vs. 7.65–9.02 mm, mean 8.33 ± SD 0.51, n = 11, P < 0.001, in Bornean A. luctuosa, and 8.21–9.38 mm, mean 8.84 ± SD 0.40, n = 11, P < 0.05, in Malay Peninsula A. luctuosa); significantly wider interorbital diameter in both sexes, with IOD of adult males 5.59–5.95 mm, mean 5.67 ± SD 0.40, n = 2 (vs. 3.78–4.70 mm, mean 4.24 ± SD 0.30, n = 22, P < 0.001, in Bornean A. luctuosa, and 3.25–5.14 mm, mean 4.35 ± SD 0.52, n = 10, P < 0.001, in Malay Peninsula A. luctuosa) and adult females 3.91–6.78 mm, mean 5.63 ± SD 1.22, n = 6 (vs. 4.15–5.60 mm, mean 4.69 ± SD 0.37, n = 11, P < 0.001, in Bornean A. luctuosa, and 3.80–5.64 mm, mean 4.93 ± SD 0.54, n = 11, P < 0.001, in Malay Peninsula A. luctuosa); significantly wider tympanum diameter in both sexes, with TD of adult males 4.54–4.60 mm, mean 4.57 ± SD 0.04, n = 2 (vs. 2.50–3.83 mm, mean 3.16 ± SD 0.29, n = 22, P < 0.001, in Bornean A. luctuosa, and 2.62–3.66 mm, mean 3.30 ± SD 0.31, n = 10, P < 0.001, in Malay Peninsula A. luctuosa) and adult females 2.27–5.63 mm, mean 4.30 ± SD 1.43, n = 6 (vs. 2.95–3.77 mm, mean 3.44 ± SD 0.25, n = 11, P < 0.001, in Bornean A. luctuosa, and 3.24–4.24 mm, mean 3.87 ± SD 0.27, n = 11, P < 0.05, in Malay Peninsula A. luctuosa); and significantly longer femur length in both sexes, FL of adult males 25.58–26.10 mm, mean 25.84 ± SD 0.37, n = 2 (vs. 17.81–21.57 mm, mean 19.72 ± SD 1.08, n = 22, P < 0.001, in Bornean A. luctuosa, and 18.38–22.04 mm, mean 20.27 ± SD 1.26, n = 10, P < 0.001, in Malay Peninsula A. luctuosa) and adult females 17.19–31.34 mm, mean 25.29 ± SD 6.53, n = 6 (vs. 19.13–23.68 mm, mean 21.73 ± SD 1.32, n = 11, P < 0.001, in Bornean A. luctuosa, and 21.55–26.37 mm, mean 23.83 ± SD 1.51, n = 11, P < 0.05, in Malay Peninsula A. luctuosa). In addition to these, the phenotypes differed significantly from each other and A. nazgul by a suite of other mensural characters (Table 4 & 5).

Taxonomy of Abavorana

Systematics and nomenclature

The analyses demonstrate unequivocally that Abavorana luctuosa on Borneo are composed of two genetically and morphologically distinct forms. Abavorana luctuosa described by Peters (1871) on the basis of a single female specimen from Sarawak (Fig. 3) has only very faint speckling on its venter and underside of the limbs. Therefore, specimens from southern Thailand, Peninsular Malaysia, and Borneo that possess this phenotype shall be referred to as A. luctuosa (Figs 4, 7E–H, 8A–F, 9A–B). The second lineage is readily identifiable by the reticulated pattern on their venters and boldly banded underside of their hind limbs, and is endemic to Borneo. Nine specimens examined from the states of Sabah (Mount Kinabalu, Kota Belud, Maliau Basin, Tambunan and Danum Valley) and Sarawak (Bario) bear this ventral colour patter and match the description of Rana decorata Mocquard, 1890 that was described from Mount Kinabalu, Sabah, East Malaysian Borneo. They resemble the colour pattern of the type series (MNHNP 1889.226–28) (Figs 5, 6, 7A–D, 9C–D). Rana decorata was synonymised with A. luctuosa by Boulenger (1891) without clear justification yet followed in subsequent works (e.g., Boulenger 1920; Van Kampen 1923; Quah et al. 2017 and references therein). Thus, given the preponderance of data, R. decorata Mocquard, 1890, in the combination Abavorana decorata comb. nov. (Mocquard, 1890) is resurrected for the populations bearing this phenotype.

Figure 3. 

Holotype of Abavorana luctuosa; A: Original illustration of the holotype of Abavorana luctuosa from Peters (1872). B: Dorsum of the holotype of A. luctuosa (MSNG 29344). C: Venter of the holotype of A. luctuosa (MSNG 29344). Photographs by Giuliano Doria.

Figure 4. 

Bornean Abavorana luctuosa; Dorsal (A & C) and ventral (B & D) pattern of Abavorana luctuosa from Borneo. A & B: Top row (from left to right); FMNH 234972, FMNH 234973, FMNH 234975 and FMNH 234977 (all specimens from Sipitang District, Sabah). Bottom row (from left to right); FMNH 234980 (Sipitang District, Sabah), FMNH 269142, FMNH 273216 and FMNH 273217 (specimens from Bintulu Division, Sarawak). C & D (from left to right): ZRC 1.11938, ZRC 1.11943 (both from Kubah, Sarawak) and ZRC 1.2270 (unspecified location in Borneo).

Figure 5. 

Syntypes of Abavorana decorata; A & D: Dorsum and venter of MNHN-RA-1889.226. B & E: Dorsum and venter of MNHN-RA-1889.227. C & F: Dorsum and venter of MNHN-RA-1889.228 (Photographs by Christine Reinhardt). G: Original illustration of the syntypes of Abavorana decorata from Mocquard (1890). Illustrations assignable to specimen MNHN-RA-1889.226 (left) and MNHN-RA-1889.228 (right).

Figure 6. 

Examined Abavorana decorata specimens; Dorsal (A & C) and ventral (B & D) pattern of Abavorana decorata from Borneo. A & B (from left to right): FMNH 109935 from Kiau, Mount Kinabalu, Sabah (left), FMNH 109936 from Kiau, Mount Kinabalu, Sabah (middle), FMNH 231052 from Danum Valley Research Center, Lahad Datu District, Sabah (top right), FMNH 128127 from Bario, Sarawak (bottom right). C & D: SP 26873 from Tawau Hills, Sabah (left) and SP 02810 from Maliau Basin, Sabah.

Abavorana luctuosa (Peters, 1871)

Common Mahogany Frog Figs 3, 4, 7E–H, 8A–F, 9A–B

Limnodytes luctuosus: Peters 1871:579, 1872:43 & pl. 6; Capocaccia 1957:208 & 215.

Rana luctuosa (in part): Boulenger 1882:68, 1891:341, 1912:238, 1920:183 & 184; Flower 1896:904, 1899:896 & 897; Hanitsch 1900:73; Butler 1904:199 & 200; Van Kampen 1923:196 & 197; Smith 1930:94 & 103, 1931:16; Capocaccia 1957: 215; Taylor & Elbel 1958:1040; Taylor 1962:451–453; Inger 1954:250, 1966:206–208, 1978:312, 1985:iii, 5, 38, 40, 56, 57, 76; Grandison 1972:66 & 67; Berry 1975:74 & 75; Dring 1979:200; Inger & Stuebing 1992:42, 2005:19, 27, 33, 149 & 150; Inger & Tan 1996:563; Inger et al. 1996:363; Manthey & Grossmann 1997:111 & 112; Khonsue & Thirakhupt 2001:73; Malkmus et al. 2002: 163–165; Das 2006a:5; Jaafar et al. 2008:39.

Rana (Limnodytes) luctuosa: Mocquard 1890:122.

Rana (Hylorana) luctuosa (in part): Boulenger 1920:126.

Rana (Hylarana) luctuosa (in part): Van Kampen 1923:196 & 197; Bourret 1942:360; Dubois, 1987: 42.

Hylorana luctuosa (in part): Deckert 1938:144.

Rana (Pulchrana) luctuosa (in part): Dubois 1992:326.

Pulchrana luctuosa (in part): Frost et al. 2006:369; Fei et al. 2010:33.

Hylarana luctuosa (in part): Manthey 1983:22; Che et al. 2007: 1–13 (by implication); Das et al. 2007:159, 160, 167, 170, fig. 7d; Imbun 2014:99.

Abavorana luctuosa: Oliver et al. 2015:186 (in part); Quah et al. 2017: 272–288 (in part); Zainudin et al. 2017:876–891 (in part); Chan et al. 2019:1057, 1062.

Hylarana (Abavorana) luctuosa (in part): Inger et al. 2017:147 & 148.

Holotype

Adult female (MSNG 29344) collected by Giacomo Doria and Odoardo Beccari from “Sarawak”, (Borneo) Malaysia (Capocaccia 1957) (Fig. 3).

Diagnosis

Body robust, medium-sized; head moderate; snout short, rounded, canthus rostralis smoothly rounded; interorbital space broader than the upper eyelid; tympanum distinct, not quite two-thirds the size of the eye with no pale colouration on the margins of the tympanum; no vocal sacs in males; vomerine teeth in two small oblique patches on a level with the posterior edge of the choanae; length of 1st finger greater than 2nd finger; disc width to finger width ratios of finger 3 and toe 4 is 1–1.5; dorsolateral fold indistinct or absent; the humeral gland in males is prominent, raised and centrally positioned on the ventral surface of the upper arm; a weak or absent rictal ridge; outer metatarsal tubercle weak or absent; subarticular tubercles moderate; skin of dorsum smooth or finely shagreened; throat, abdomen, and flanks smooth; posterior section of venter and back of the thigh rugose; dorsum reddish-orange to chocolate-brown, encircled by a white or cream coloured dorsolateral line that encircles the snout, canthus rostralis, outer edge of the upper eyelids, and dorsum along the dorsolateral fold to the vent; lower flanks dark-brown or black below the dorsolateral line grading into a paler venter; dorsal colouration of the limbs same as the flanks with whitish or light-grey speckles or stripes. Abavorana luctuosa can be easily differentiated from its congeners on the basis of its ventral colour pattern which is usually immaculate or with only very faint, sparse, light speckling (Figs 3, 4, 9A–B). Adult males with SVL 35.05–44.27 mm, adult females with SVL 37.05–51.06 mm; adult males with SW 7.11–8.62 mm, adult females with SW 7.65–9.38 mm; adult males with IOD 3.25–5.14 mm, adult females with IOD 3.80–5.64 mm; adult males with TD 2.50–3.83 mm, adult females with TD 2.95–4.24 mm; adult males with FL 17.81–22.04 mm, adult females with FL 19.13–26.37 mm (Table 5).

Distribution

Its distribution spans southern Peninsular Thailand, Peninsular Malaysia, Borneo, and Sumatra (Manthey & Grossmann 1997; Oliver et al. 2015; Quah et al. 2017). Within Borneo it is confirmed from Sabah state: Imbak Canyon and Sipitang; Sarawak state: Bukit Kana, Samarakan and Tubau in Bintulu Division and Kubah National Park where it is sympatric with Abavorana decorata (Fig. 10). The species is expected to range across Borneo.

Abavorana decorata comb. nov. (Mocquard, 1890)

Decorated Mahogany Frog Figs 5, 6, 7A–D, 9C–D

Rana decorata: Mocquard 1890:145–146; Guibé 1950:41

Rana luctuosa (in part): Boulenger 1891:341 & 342, 1912:238, 1920:183 & 184; Flower 1896:904, 1899:896 & 897; Hanitsch 1900:73; Butler 1904:199; Smith 1931:16; Van Kampen 1923:196 & 197; Taylor 1962:451–453; Inger 1954:250, 1966:206–208, 1978:312, 1985:iii, 5, 38, 40, 56, 57, 76; Grandison 1972:66 & 67; Berry 1975:74 & 75, Fig. 50 (right); Matsui 1979:333; Inger & Stuebing 1992:42, 2005:19, 27, 33, 149 & 150; Inger & Tan 1996:563; Inger et al. 1996:363; Malkmus 1994:244; Manthey & Grossmann 1997:111 & 112; Khonsue & Thirakhupt 2001:73; Malkmus et al. 2002: 163–165, figs 159, 160; Das 2006a:5.

Rana (Hylorana) luctuosa (in part): Boulenger 1920:126.

Rana (Hylarana) luctuosa (in part): Van Kampen 1923:196 & 197; Bourret 1942:360; Dubois, 1987: 42.

Hylorana luctuosa (in part): Deckert 1938:144

Rana (Pulchrana) luctuosa (in part): Dubois 1992:326

Pulchrana luctuosa (in part): Frost et al. 2006:369; Fei et al. 2010:33.

Hylarana luctuosa (in part): Manthey 1983:22; Che et al. 2007: 1–13 (by implication); Das et al. 2007:159, 160, 167, 170; Imbun 2014:99.

Abavorana luctuosa: Oliver et al. 2015:186 (in part); Quah et al. 2017: 272–288 (in part); Zainudin et al. 2017:876–891 (in part); Haas et al. 2018:92, 93, 100, fig. 4b.

Hylarana (Abavorana) luctuosa (in part): Inger et al. 2017:147 & 148.

Syntypes

MNHNP 1889.226–28 from “Bornéo Kina Balu”, Sabah (Borneo), Malaysia. (Guibé 1950) (Fig. 5).

Diagnosis

In addition to its phylogenetic placement (Fig. 1), Rana decorata is reassigned as a member of the genus Abavorana based on the combination of having a robust, medium-sized body; no vocal sacs in males; length of 1st finger greater than 2nd finger; disc width to finger width ratios of finger 3 and toe 4 is 1–1.5; dorsolateral fold indistinct or absent; the colour of the dorsolateral line being white or yellow; the humeral gland in males is prominent, raised and centrally positioned on the ventral surface of the upper arm; a weak or absent rictal ridge; outer metatarsal tubercle weak or absent; skin of dorsum smooth or finely shagreened; throat, abdomen and flanks smooth; posterior section of venter and back of the thigh rugose; no pale colouration on the margins of the tympanum; flanks dark-brown or black below the dorsal fold grading into a pale venter (Inger 1966; Oliver et al. 2015; Quah et al. 2017). Dorsum reddish-orange to rust-brown, encircled by a white or cream coloured dorsolateral line that encircles the snout, canthus rostralis, outer edge of the upper eyelids, and dorsum along the dorsolateral fold to the vent; lower flanks dark-brown or black below the dorsolateral line grading into a paler venter; dorsal colouration of the limbs light-grey or brown with speckling and prominent dark-brown or black bands. Abavorana decorata can be differentiated from its congeners on the basis of its ventral colour pattern which is reticulated in black and white especially on the lower flanks, underside of the limbs (especially hind-limbs) are boldly banded in black and white, and a prominent white streak under the eye and/or tympanum to the corner of the jaw (Figs 5, 6, 9C–D). Adult males with SVL 46.21–56.0 mm, adult females with SVL 29.66–58.42 mm; adult males with SW 9.91–10.71 mm, adult females with SW 6.25–11.68 mm; adult males with IOD 5.59–5.95 mm, adult females with IOD 3.91–6.78 mm; adult males with TD 4.54–4.60 mm, adult females with TD 2.27–5.63 mm; adult males with FL 25.58–26.10 mm, adult females with FL 17.19–31.34 mm (Table 5).

Distribution (Fig. 10). Endemic to Borneo. The species is known from Sabah state, Malaysian Borneo: Mount Kinabalu, Kampung Kiau Taburi, Danum Valley, Tawau Hills Park, Maliau Basin, Tambunan and Penampang (CalPhotos ID: 0000 0000 0912 1159); Sarawak state, Malaysia Borneo: Kubah National Park (Fig. 7C) and Bario (Fig. 6A–B); and West Kalimantan, Indonesia: Melawi Regency (Fig. 7D). The species is expected to be wider ranging on the island.

Figure 7. 

Living specimens of Abavorana decorata and Bornean A. luctuosa; A: Abavorana decorata from Tawau Hills, Sabah, East Malaysia. B: A. decorata from Maliau Basin, Sabah, East Malaysia. C: A. decorata from Kubah National Park, Sarawak, East Malaysia. D: A. decorata from Melawi Regency, West Kalimantan Province, Indonesia. E & F: A. luctuosa from Kubah National Park, Sarawak, East Malaysia. G: A. luctuosa (FMNH 238720) from Sipitang, Sabah, East Malaysia. H: A. luctuosa (FMNH 242883) from Sipitang, Sabah, East Malaysia. (Photographs by Alexander Haas [A, C & E], Paul Bertner [B], Muhammad Aini [D], Chien C. Lee [F], and Robert F. Inger [G & H], Figs G & H ©Field Museum of Natural History. Created by Field Museum of Natural History, Amphibian and Reptile Collection and licensed under CC-BY-SA 4.0).

Abavorana nazgul Quah, Shahrul Anuar, Grismer, Wood, Siti Azizah & Muin 2017

Gunung Jerai Black Stream-Frog Figs 8G–H, 9E–F

Rana luctuosa Sukumaran, J. 2005: 38

Holotype

An adult male (USMHC 2231) collected on 9 April 2016 from Gunung Jerai, Kedah, Peninsular Malaysia (5°47.719’N; 100°26.222’E, 948 m in elevation) by Evan S.H. Quah and David Chan.

Diagnosis

Abavorana nazgul can be differentiated from its congeners by the following combination of characters: adult males 41.51–44.1 mm SVL and single adult female 52.51 mm; adult males with SW 7.98–8.70 mm, single adult female SW 9.59 mm; adult males with IOD 3.94–4.48 mm, single adult female IOD 4.94 mm; adult males with TD 3.52–4.01 mm, single adult female TD 4.10 mm; adult males with FL 22.20–23.22 mm, single adult female FL 27.80 mm; nuptial pads absent in males; humeral glands in males small (2.4–2.98 mm) (Table 5); dorsolateral stripe continuous, orange to yellow in colour; dorsum between dorsolateral stripes black, with or without faint orange or yellow speckles; flanks black, colouration unstratified; distinct cream-colored spots on flanks, dorsal surfaces of limbs, and upper lip; venter grey-brown with prominent light spots on throat and belly, smaller spots on underside of thigh (Fig. 9E–F; Quah et al. 2017).

Distribution

Abavorana nazgul is thus far confirmed from the upper elevations of Gunung Jerai, Kedah, Peninsular Malaysia (Quah et al. 2017). Specimens resembling this species have been photographed at Thale Ban National Park, Satun Province in southern Thailand at approximately 500–600m in elevation around wild boar wallows but are only tentatively identified as A. cf. nazgul pending positive evidence (Fig. 8H).

Figure 8. 

Peninsular Malaysian, Thai and Sumatran Abavorana luctuosa, and A. nazgul; A: A. luctuosa from Sungai Durian Forest Reserve, Kelantan, Peninsular Malaysia. B: A. luctuosa from Janda Baik, Pahang, Peninsular Malaysia. C: A. luctuosa from Semenyih, Selangor, Peninsular Malaysia. D: A. luctuosa from Fraser’s Hill, Pahang, Peninsular Malaysia. E: A. luctuosa from Hala-Bala Wildlife Sanctuary, Thailand. F: A. luctuosa from Sumatra, Indonesia. G: A. nazgul (USMHC 2572) from Gunung Jerai, Kedah, Peninsular Malaysia. H. A. cf. nazgul from Thale Ban National Park, Satun Province, Thailand. (Photographs by Zaharil Dzulkafly [A], Steven Wong [B], Kurt H.P. Guek [C], Evan Quah [D & G], Ian Dugdale [E], Hellen Kurniati [F] & Bunyarit Dechochai [H]).

Figure 9. 

Colour pattern comparison among species of the genus Abavorana; Dorsum (A,C & E) and venter (B,D & F) in life of A. luctuosa (USMHC 2576) (A & B) from Penang Hill, Penang Island, Malaysia, A. decorata from Maliau Basin, Sabah, East Malaysia, Borneo (C & D) and A. nazgul (USMHC 2233) (E & F) from Gunung Jerai, Kedah, West Malaysia. (Photographs by Evan Quah [A, B, E & F] and Stefan T. Hertwig [C & D]).

Figure 10. 

Distribution map of Abavorana decorata and A. luctuosa in Borneo; Known distribution of Abavorana decorata (red) and A. luctuosa (blue) in Borneo. Star = type locality.

Discussion

Prior to this study and that of Quah et al. (2017), Inger (1966) and Grandison (1972) noted that Peninsular Malaysian Abavorana luctuosa were smaller than Bornean populations and lacked stripes on the undersides of their limbs but did not realise they were comparing two different species, A. luctuosa and A. decorata. Abavorana decorata is recovered as the sister species to the remainder of the genus and this study suggests that the ancestor of the genus possibly originated in Borneo before dispersing across Sundaland where one lineage gave rise to A. nazgul in the uplands of northwestern Peninsular Malaysia and possibly southern Thailand, and the second lineage gave rise to the widespread A. luctuosa. These findings lend credence to the out-of-Borneo hypothesis that has been postulated for a number of other herpetofaunal taxa and other biotic groups (de Bruyn et al. 2014; Grismer et al. 2016; Quah et al. 2020b). Alternatively, the present-day endemism of A. decorata on Borneo might be the result of extinction in other parts of Southeast Asia, the mainland in particular. Abavorana decorata may have had a far more extensive distribution across Sundaland previously. Nevertheless, both hypotheses can be explored in greater detail in the future with biogeographic range evolution analysis based on larger molecular datasets and broader taxon sampling for both Abavorana and other related genera across Sundaland.

Borneo has long been a focal point of herpetological research in Southeast Asia (Das 2006b, 2007; Inger et al. 2017; Malkmus et al. 2002; Stuebing et al. 2014 and references within), and new discoveries continue to be made especially with the aid of molecular data and careful taxonomic reappraisals (for example, Davis et al. 2019; Grismer et al. 2018; Hertwig et al. 2012; Karin et al. 2018; Matsui et al. 2020; Mediyansyah et al. 2019; Munir et al. 2019; Pui et al. 2017; Quah et al. 2019a, 2020a). Our findings continue to lend support to the growing evidence that widely distributed species tend to be complexes and that their true diversity is not fully realised in the region (such as Arifin et al. 2018; Chan et al. 2020a,b; Grismer et al. 2018; Mediyansyah et al. 2019; Munir et al. 2019; Quah et al. 2019a, 2020a). Our data also reveal some significant differences in the measurements of Abavorana luctuosa populations from the Thai-Malay Peninsula and Borneo which, along with the genetic data and their allopatry, indicates that these populations are evolving on separate evolutionary trajectories, which makes them candidates for their recognition as distinct species. However, we continue to consider them as conspecific due to their low genetic divergence (2.0–3.0 %) based on ND1, 16S and tRNAs of mitochondrial DNA. We are adopting a conservative approach for now pending a more extensive genetic examination as other studies using genomic datasets have revealed past hybridization events between Bornean and Thai-Malay Peninsula populations of other anuran species complexes (Chan et al. 2020c).

Key to the species of the genus Abavorana

1 Mid-dorsal region of dorsum orange or reddish-brown 2
Mid-dorsal region of dorsum generally black, sometimes with faint orange or yellow speckles, venter with light spots A. nazgul
2 Venter immaculate or with only very fine, light speckling on flanks and underside of legs, and absence or only faint white streak under the eye and/or tympanum to the corner of the jaw A. luctuosa
Venter with light and dark spots or reticulations especially along the flanks, and underside of legs boldly marked with black and white reticulations or barring, and a prominent white streak under the eye and/or tympanum to the corner of the jaw A. decorata

Acknowledgements

We thank the Department of Wildlife and National Parks, Peninsular Malaysia for issuing a research permit (JPHL&TN (IP): 100-34/1.24 Jld 14 (71)). We are also indebted to Alan Resetar and Joshua Mata of FMNH, as well as Rimi Repin and Fred Tuh Yit Yu of Sabah Parks for loaning material and granting us permission to examine specimens in their collection. We are also grateful to the FMNH, Alexander Haas, Chien C. Lee, Stefan T. Hertwig, Christine Reinhardt, Steven Wong, Kurt H.P. Guek, Ian Dugdale, Zaharil Dzulkafly, Giuliano Doria, Helen Kurniati, Bunyarit Dechochai, Paul Bertner, Muhammad Aini, Kawin Jiaranaisakul and Parinya Pawangkhanant who contributed photographs which aided our work. Museum work by ESHQ at the LKCNHM was partially funded by the LKCNHM Fellowship Scheme. He would also like to thank the Fulbright program, the Malaysian-American Commission on Educational Exchange (MACEE) and the Institute of International Education (IIE) for funding and the opportunity to complete this research project at La Sierra University, Riverside, California. L. Lee Grismer was partly funded by the college of Arts and Sciences at La Sierra University, while research by Shahrul Anuar was supported by FRGS Ministry of Higher Education, Malaysia (6711779). This paper is contribution number 936 of the Auburn University Museum of Natural History. Finally, we would like to thank Alexander Haas, Bryan L. Stuart and Raffael Ernst for reviewing our paper and providing us with constructive feedback that improved our publication.

References

  • Arifin U, Smart U, Hertwig ST, Smith EN, Iskandar DT, Haas A (2018) Molecular phylogenetic analysis of a taxonomically unstable ranid from Sumatra, Indonesia, reveals a new genus with gastromyzophorous tadpoles and two new species. Zoosystematics and Evolution 94: 163–193. https://doi.org/10.3897/zse.94.22120
  • Berry PY (1975) The amphibian fauna of Peninsular Malaysia. Tropical Press, Kuala Lumpur, 127 pp.
  • Boulenger GA (1882) Catalogue of the Batrachia Salientia s. Ecaudata in the Collection of the British Museum. 2nd edition. Taylor and Francis, London, 503 pp. https://doi.org/10.5962/bhl.title.8307
  • Boulenger GA (1912) A vertebrate fauna of the Malay Peninsula from the Isthmus of Kra to Singapore including the adjacent islands. Reptilia and Batrachia. Taylor & Francis, London, 294 pp. https://doi.org/10.5962/bhl.title.10813
  • Bouckaert RR, Heled J, Kühnert D, Vaughan T, Wu CH, Xie D, Suchard MA, Rambaut A, Drummond AJ (2014) BEAST 2: a software platform for Bayesian evolutionary analysis. PLoS Computational Biology 10: e1003537. https://doi.org/10.1371/journal.pcbi.1003537
  • Bourret R (1942) Les Batraciens de l’lndochine. lnstitut Oceanographique de l’lndochine, Hanoi, 547 pp.
  • Butler AL (1904) A list of the batrachians known to inhabit the Malay Peninsula, with some remarks on their habits and distribution. Journal of the Bombay Natural History Society 15: 193–205.
  • Camargo A, De Sa RO, Heyer WR (2006) Phylogenetic analyses of mtDNA sequences reveal three cryptic lineages in the widespread neotropical frog Leptodactylus fuscus (Schneider, 1799) (Anura, Leptodactylidae). Biological Journal of the Linnean Society 87: 325–341. https://doi.org/10.1111/j.1095-8312.2006.00581.x
  • Capocaccia L (1957) Catalogo dei tipi di anfibi del Museo Civico di Storia Naturale di Genova. Annali del Museo Civico di Storia Naturale di Genova 3: 208–222.
  • Chan KO, Abraham RK, Badli-Sham BH (2020a) A revision of the Asian tree toad complex Rentapia hosii (Anura: Bufonidae) with the description of a new species from Peninsular Malaysia. Raffles Bulletin of Zoology 68: 595–607.
  • Chan KO, Abraham RK, Grismer LL, Brown RM (2020b) A systematic review of the Pulchrana picturata complex, with the description of a new species from Peninsular Malaysia, Sumatra, and southern Thailand. Raffles Bulletin of Zoology 68: 880–890.
  • Chan KO, Hutter CR, Wood JrPL, Grismer LL, Das I, Brown RM (2020c) Gene flow creates a mirage of cryptic species in a Southeast Asian spotted stream frog complex. Molecular Ecology 29: 3970–3987. https://doi.org/10.1111/mec.15603
  • Chan KO, Muin MA, Anuar S, Andam J, Razak N, Aziz MA (2019) First checklist on the amphibians and reptiles of Mount Korbu, the second highest peak in Peninsular Malaysia. Check List 15: 1055–1069. https://doi.org/10.15560/15.6.1055
  • Che J, Pang J, Zhao H, Wu GF, Zhao EM, Zhang YP (2007) Phylogeny of Raninae (Anura: Ranidae) inferred from mitochondrial and nuclear sequences. Molecular Phylogenetics and Evolution 43: 1–13. https://doi.org/10.1016/j.ympev.2006.11.032
  • Davis HR, Bauer AM, Jackman TR, Nashriq I, Das I (2019) Uncovering karst endemism within Borneo: two new Cyrtodactylus species from Sarawak, Malaysia. Zootaxa 4614: 331–352. https://doi.org/10.11646/zootaxa.4614.2.4
  • de Bruyn M, Stelbrink B, Morley RJ, Hall R, Carvalho GR, Cannon CH, van den Bergh G, Meijaard E, Metcalfe I, Boitani L, Maiorano L, Shoup R, von Rintelen T (2014) Borneo and Indochina are major evolutionary hotspots for Southeast Asian biodiversity. Systematic Biology 63: 879–901. https://doi.org/10.1093/sysbio/syu047
  • Das I (2006a) Crocker Range National Park, Sabah, as a refuge for Borneo’s montane herpetofauna. Amphibian and Reptile Conservation 4: 3–11.
  • Das I (2006b) A Photographic Guide to Snakes and other Reptiles of Borneo. New Holland Publishers Ltd., London, 144 pp.
  • Das I (2007) Amphibians and Reptiles of Brunei: A Pocket Guide. Natural History Publications (Borneo), Kota Kinabalu, 200 pp.
  • Das I, Jankowski A, Makmor MIB, Haas A (2007) Species diversity, elevational distribution and reproductive modes in an amphibian community at the Matang Range, Sarawak (Borneo). Mitteilungen aus dem Hamburgischen Zoologischen Museum und Institut 104: 141–174.
  • Deckert K (1938) Beiträge zur Osteologie und Systematik ranider Froschlurche. Sitzungsberichte der Gesellschaft Naturforschender Freunde zu Berlin 1938: 127–184.
  • Dubois A (1987) Miscellanea taxinomica batrachologica (I). Alytes 5: 7–95.
  • Dubois A (1992) Notes sur la classification des Ranidae (Amphibiens anoures). Bulletin Mensuel de la Société Linnéenne de Lyon 61: 305–352.
  • Dring JC (1979) Amphibians and reptiles from northern Trengganu, Malaysia, with descriptions of two new geckos: Cnemaspis and Cyrtodactylus. Bulletin of the British Museum of Natural History (Zoology) 34: 181–241.
  • Fei L, Ye C, Jiang J (2010) Phylogenetic systematics of Ranidae. Herpetologica Sinica 12: 1–43.
  • Flower SS (1896) Notes on a second collection of batrachians made in the Malay Peninsula 1895–96, with a list of the species recorded from that region. Proceedings of the Zoological Society of London 1896: 856–914. https://doi.org/10.1111/j.1096-3642.1896.tb03085.x
  • Flower SS (1899) Notes on a second collection of batrachians made in the Malay peninsula and Siam from November 1896 to September 1898, with a list of the species recorded from these countries. Proceedings of the Zoological Society of London 1899: 885–916. https://doi.org/10.1111/j.1469-7998.1899.tb06880.x
  • Frost DR, Grant T, Faivovich J, Bain RH, Haas A, Haddad CFB, de Sá RO, Channing A, Wilkinson M, Donnellan SC, Raxworthy CJ, Campbell JA, Blotto BL, Moler PE, Drewes RC, Nussbaum RA, Lynch JD, Green DM, Wheeler WC (2006) The amphibian tree of life. Bulletin of the American Museum of Natural History 297: 1–291. https://doi.org/10.1206/0003-0090(2006)297[0001:tatol]2.0.co;2
  • Grandison AGC (1972) The Gunong Benom Expedition 1967. 5. Reptiles and amphibians of Gunong Benom with a description of a new species of Macrocalamus. Bulletin of the British Museum of Natural History (Zoology) 23: 45–101
  • Grismer LL, Quah ESH, Zaharil D, Yambun P (2018) On the taxonomy of Lygosoma bampfyldei Bartlett, 1895 (Squamata: Scincidae) with descriptions of new species from Borneo and Peninsular Malaysia and the resurrection of Lygosoma schneideri Werner, 1900. Zootaxa 4438: 528–550. https://doi.org/10.11646/zootaxa.4438.3.6
  • Grismer LL, Wood JrPL, Aowphol A, Cota M, Grismer MS, Murdoch M, Aguilar C, Grismer JL (2016) Out of Borneo, again and again: biogeography of the Stream Toad genus Ansonia Stoliczka (Anura: Bufonidae) and the discovery of the first limestone cave-dwelling species. Biological Journal of the Linnean Society 120: 371–395. https://doi.org/10.1111/bij.12886
  • Guibé J (1950) Catalogue des types d’amphibiens du Muséum national d’Histoire naturelle. Imprimerie nationale, Paris, 71 pp.
  • Haas A, Kueh BH, Joseph A, Asri Mb, Das I, Hagmann R, Schwander L, Hertwig ST (2018) An updated checklist of the amphibian diversity of Maliau Basin Conservation Area, Sabah, Malaysia. Evolutionary Systematics 2: 89–114. https://doi.org/10.3897/evolsyst.2.27020
  • Hertwig ST, Das I, Schweizer M, Brown R, Haas A (2012) Phylogenetic relationships of the Rhacophorus everetti-group and implications for the evolution of reproductive modes in Philautus (Amphibia: Anura: Rhacophoridae). Zoologica Scripta 41: 29–46. https://doi.org/10.1111/j.1463-6409.2011.00499.x
  • Hoang DT, Chernomor O, Von Haeseler A, Minh BQ, Vinh LS (2017) UFBoot2: improving the ultrafast bootstrap approximation. Molecular Biology and Evolution 35: 518–522. https://doi.org/10.1093/molbev/msx281
  • Huelsenbeck JP, Ronquist F, Nielsen R, Bollback JP (2001) Bayesian inference of phylogeny and its impact on evolutionary biology. Science 294: 2310–2314. https://doi.org/10.1126/science.1065889
  • Imbun PY (2014) Amfibia Sabah. Dewan Bahasa dan Pustaka, Kuala Lumpur, 194 pp.
  • Inger RF (1954) On a collection of amphibians from Mount Kina Balu, North Borneo. Journal of the Washington Academy of Sciences 44: 250–251.
  • Inger RF (1978) The frogs & toads. Chapter 13. In: Luping M, Chin W, Dingley ER (Eds) Kinabalu, Summit of Borneo. Sabah Society, Kota Kinabalu, Sabah, 311–320.
  • Inger RF, Stuebing RB (1992) The montane amphibian fauna of northwestern Borneo. Malayan Nature Journal 46: 41–51.
  • Inger RF, Stuebing RB (2005) A Field Guide to the Frogs of Borneo. 2nd Edition. Natural History Publications (Borneo) Sdn. Bhd. , Kota Kinabalu, Sabah, 201 pp.
  • Inger RF, Stuebing RB, Grafe TU, Dehling JM (2017) A Field Guide to the Frogs of Borneo. 3rd Edition. Natural History Publications (Borneo) Sdn Bhd. , Kota Kinabalu, Sabah, 228 pp.
  • Inger RF, Stuebing RB, Tan FL (1996) Frogs & toads. In: Wong KM, Phillipps A (Eds) Kinabalu: Summit of Borneo. Sabah Society; Sabah Parks, Kota Kinabalu, Sabah, 352–367.
  • Inger RF, Tan FL (1996) Checklist of the frogs of Borneo. The Raffles Bulletin of Zoology 44: 551–574.
  • Jaafar I, Shahrul AMS, Ahmad N, Chan KO, Muin MAM (2008) The common amphibians and reptiles of Penang Island. State Forestry Department of Penang, Penang, 116 pp.
  • Jombart T, Devillard S, Balloux F (2010) Discriminant analysis of principal components: a new method for the analysis of genetically structured populations. BMC Genetics 11: 94. https://doi.org/10.1186/1471-2156-11-94
  • Kalyaanamoorthy S, Minh BQ, Wong TKF, von Haeseler A, Jermiin LS (2017) ModelFinder: fast model selection for accurate phylogenetic estimates. Nature Methods 14: 587–589. https://doi.org/10.1038/nmeth.4285
  • Katoh K, Misawa K, Kuma K, Miyata T (2002) MAFTT: a novel method for rapid sequence alignment based on fast Fourier transform. Nucleic Acids Research 30: 3059–3066. http://doi.org/10.1093/nar/gkf436
  • Karin BR, Freitas ES, Shonleben S, Grismer LL, Bauer AM, Das I (2018) Unrealized diversity in an urban rainforest: a new species of Lygosoma (Squamata: Scincidae) from western Sarawak, Malaysia (Borneo). Zootaxa 4370: 345–362. https://doi.org/10.11646/zootaxa.4370.4.2
  • Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, Duran C, Thierer T, Ashton B, Meintjes P, Drummond A (2012) Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28: 1647–1649. http://doi.org/10.1093/bioinformatics/bts199
  • Khonsue W, Thirakhupt K (2001) A checklist of the amphibians of Thailand. Natural History Journal of Chulalongkorn University, 1, 69–82.
  • Lleonart J, Salat J, Torres GJ (2000) Removing allometric effects of body size in morphological analysis. Journal of Theoretical Biology 205: 85–93. https://doi.org/10.1006/jtbi.2000.2043
  • Maddison W, Maddison D (2019) Mesquite: a modular system for evolutionary analysis. version 3.51. 2018.
  • Malkmus R, Manthey U, Vogel G, Hoffmann P, Kosuch J (2002) Amphibians and Reptiles of Mount Kinabalu (North Borneo). A.R.G. Ganter Verlag, Ruggel, 424 pp.
  • Manthey U (1983) Exkursion am Mt. Kinabalu 4100 m, Nord – Borneo. Teil 3: Checkliste der Herpetofauna oberhalb 600m üNN. – herpetofauna, Weinstadt 5: 20–31.
  • Manthey U, Grossmann W (1997) Amphibien & Reptilien Südostasiens. Natur und Tier Verlag, Münster, 512 pp.
  • Matsui M (1979) Amphibians from Sabah I. Systematic and natural history notes. Contributions from the Biological Laboratory, Kyoto University 25: 303–346.
  • Matsui M, Nishikawa K, Eto K, Hossman MY (2020) Two New Ansonia from Mountains of Borneo (Anura, Bufonidae). Zoological Science 37: 91–101. https://doi.org/10.2108/zs190078
  • Mediyansyah M, Hamidy A, Munir M, Matsui M (2019) A new tree frog of the genus Kurixalus Ye, Fei & Dubois, 1999 (Amphibia: Rhacophoridae) from West Kalimantan, Indonesia. Treubia 46: 51–72. https://doi.org/10.14203/treubia.v46i0.3790
  • Munir M, Hamidy A, Matsui M, Iskandar DT, Sidik I, Shimada T (2019) A new species of Megophrys Kuhl & Van Hasselt (Amphibia: Megophryidae) from Borneo allied to M. nasuta (Schlegel, 1858). Zootaxa 4679: 1–24. https://doi.org/10.11646/zootaxa.4679.1.1
  • Nguyen LT, Schmidt HA, von Haeseler A, Minh BQ (2015) IQ-TREE: A fast and effective stochastic algorithm for estimating maximum likelihood phylogenies. Molecular Biology and Evolution 32: 268–274. http://doi.org/10.1093/molbev/msu300
  • Mocquard F (1890) Recherches sur la faune herpetologique des iles de Bornéo et de Palawan. Nouvelles Archives du Muséum d’Histoire Naturelle Paris 3: 115–168.
  • Oliver LA, Prendini E, Kraus F, Raxworthy CJ (2015) Systematics and biogeography of the Hylarana frog (Anura: Ranidae) radiation across tropical Australasia, Southeast Asia, and Africa. Molecular Phylogenetics and Evolution 90: 176–192. https://doi.org/10.1016/j.ympev.2015.05.001
  • Peters WCH (1871) Über neue Reptilien aus Ostafrica und Sarawak (Borneo), vorzüglich aus der Sammlung des Hrn. Marquis J. Doria zu Genua. Monatsberichte der Königlichen Preussische Akademie des Wissenschaften zu Berlin 1871: 566–581.
  • Peters WCH (1872) Übersicht der von den Herren Ma. G. Doria und Dr. O. Beccari in Sarawack auf Borneo von 1865 bis 1868 gesammelten Amphibien. Annali del Museo civico di Storia naturale Giacomo Doria 1: 27–45.
  • Pui YM, Karin BR, Bauer AM, Das I (2017) A new species of Tropidophorus Duméril & Bibron, 1839 (Squamata: Sauria: Scincidae) from Sarawak, East Malaysia (Borneo). Zootaxa 4258: 539–550. https://doi.org/10.11646/zootaxa.4258.6.3
  • Quah ESH, Shahrul AMS, Grismer LL, Wood JrPL, Siti AMN, Muin MA (2017) A new species of frog of the genus Abavorana Oliver, Prendini, Kraus & Raxworthy 2015 (Anura: Ranidae) from Gunung Jerai, Kedah, northwestern Peninsular Malaysia. Zootaxa 4320: 272–288. https://doi.org/10.11646/zootaxa.4320.2.4
  • Quah ESH, Grismer LL, Lim KKP, Shahrul AMS, Imbun PY (2019) A taxonomic reappraisal of the Smooth Slug Snake Asthenodipsas laevis (Boie, 1827) (Squamata: Pareidae) in Borneo with the description of two new species. Zootaxa 4646: 501–526. https://doi.org/10.11646/zootaxa.4646.3.4
  • Quah ESH, Grismer LL, Lim KKP, Shahrul AMS, Chan KO (2020a) A taxonomic revision of Asthenodipsas malaccana Peters, 1864 (Squamata: Pareidae) with a description of a new species from Borneo. Zootaxa 4729: 1–24. https://doi.org/10.11646/zootaxa.4729.1.1
  • Quah ESH, Shahrul A, Grismer LL, Wood JrPL, Siti AMN (2020b) Systematics and natural history of mountain reed snakes (genus Macrocalamus; Calamariinae). Zoological Journal of the Linnean Society 188: 1236–1276. https://doi.org/10.1093/zoolinnean/zlz092
  • R Core Team (2015) R: A language and environment for statistical computing. R foundation for Statistical Computing. Vienna. Available from: http://www.R-project.org (accessed 26 October 2020)
  • Rambaut A, Drummond AJ, Xie D, Baele G, Suchard MA (2018) Posterior summarisation in Bayesian phylogenetics using Tracer 1.7. Systematic Biology 67: 901–904. https://doi.org/10.1093/sysbio/syy032
  • Shimada T, Matsui M, Yambun P, Sudin A (2011) A taxonomic study of Whitehead’s torrent frog, Meristogenys whiteheadi, with descriptions of two new species (Amphibia: Ranidae). Zoological Journal of the Linnean Society 161: 157–183. https://doi.org/10.1111/j.1096-3642.2010.00641.x
  • Smith MA (1930) The reptilia and amphibia of the Malay Peninsula from the Isthmus of Kra to Singapore including the adjacent islands. A supplement to G.A. Boulenger’s Reptilia and Batrachia, 1912. Bulletin of the Raffles Museum 3: 1–149.
  • Smith MA (1931) The herpetology of Mt. Kinabalu, North Borneo, 13,455 ft. Bulletin of the Raffles Museum 5: 8–32.
  • Stuebing RB, Inger RF, Lardner B (2014) A field guide to the snakes of Borneo. 2nd Edition. Natural History Publications (Borneo), Kota Kinabalu, 310 pp.
  • Sukumaran J (2005) Anuran Assemblages of Gunung Jerai, Kedah, Peninsular Malaysia. M.Sc. Thesis. Kuala Lumpur, Malaysia: Faculty of Science, University of Malaya.
  • Tamura K, Stretcher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Molecular Biology and Evolution 30: 2725–2729. https://doi.org/10.1093/molbev/mst197
  • Thorpe RS (1983) A review of the numerical methods for recognizing and analyzing racial differentiation. In: Felsenstein J (Ed.) Numerical Taxonomy: Proceedings of a NATO Advanced Studies Institute NATO ASI series. Springer Verlag, Berlin, Heidelberg, 404–423. https://doi.org/10.1007/978-3-642-69024-2_43
  • Trifinopoulos J, Nguyen LT, von Haeseler A, Minh BQ (2016) W-IQ-TREE: a fast online phylogenetic tool for maximum likelihood analysis. Nucleic acids research 44: W232–W235. https://doi.org/10.1093/nar/gkw256
  • Zainudin R, Zain BMM, Ahmad N, Nor SM (2017) Microhabitat partitioning of closely related Sarawak (Malaysian Borneo) frog species previously assigned to the genus Hylarana (Amphibia: Anura). Turkish Journal of Zoology 41: 876–891.