Research Article |
|
Corresponding author: Oscar Flores-Villela ( villelahp@gmail.com ) Academic editor: Uwe Fritz
© 2021 Gustavo Campillo-García, Oscar Flores-Villela, Brett Oliver Butler, Julián Andrés Velasco Vinasco, Fabiola Ramírez Corona.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Campillo-García G, Flores-Villela O, Butler BO, Velasco Vinasco JA, Ramírez Corona F (2021) Hidden diversity within a polytypic species: The enigmatic Sceloporus torquatus Wiegmann, 1828 (Reptilia, Squamata, Phrynosomatidae). Vertebrate Zoology 71: 781-798. https://doi.org/10.3897/vz.71.e71995
|
The spiny lizard genus Sceloporus was described by Wiegmann in 1828, with S. torquatus posteriorly designated as the type species. The taxonomic history of S. torquatus is complicated, as it has been confused with other taxa by numerous authors. Many modern systematics works have been published on Sceloporus, but none have included all five recognized S. torquatus subspecies: S. t. torquatus, S. t. melanogaster, S. t. binocularis, S. t. mikeprestoni, and S. t. madrensis. Additionally, there is previous evidence for at least one unnamed taxon. The present study is the first taxonomic revision of the enigmatic S. torquatus based on molecular phylogenies using combined molecular data from 12S, ND4 and RAG1 genes, and Maximum Likelihood and Bayesian inference phylogenetic methods. This work includes the most extensive sampling across the entire distribution, as well as divergence time estimates and environmental niche modelling, which combined offer a spatio-temporal framework for understanding the evolution of the species. Additionally, a series of morphological characters are analyzed to identify significant differences between lineages consistently recovered in the molecular phylogenies. Using this integrative approach, evidence is presented for eight lineages within the S. torquatus complex, five of which correspond to previously recognized subspecies and three represent unnamed taxa masked by morphological conservatism. Finally, to maintain taxonomic stability a lectotype and paralectoype are designated for S. torquatus, and certain taxonomic changes are suggested in order to reflect the phylogenetic relationships within the S. torquatus complex.
Collared spiny lizard, Ecological Niche Modelling, integrative taxonomy
If we were to choose a representative genus of North American reptiles, Sceloporus Wiegmann, 1828 would certainly be a good candidate, as it is one of the most diverse and conspicuous. Sceloporus is a genus of Phrynosomatid lizards distributed from southern Canada to western Panama with over 100 species (Sites et al. 1992;
Sceloporus has proven to be an ideal group to study systematics (Sites et al. 1992), and consequently the molecular systematics of the genus has been very dynamic and fundamental for the understanding of phylogenetic relationships as well as in the practice of species delimitation (
Despite the amount of published data on the group, controversy persists about the recognition of species and the phylogenetic relationships at species group level in the genus Sceloporus. In addition, sampling of some species and subspecies is still incomplete (
Sceloporus torquatus is the type species of the genus (
Previous works included sampling of three of the five recognized subspecies as well as molecular evidence for an unnamed taxon from western Mexico related to S. torquatus (
Herein we perform the first taxonomic revision of the five subspecies of S. torquatus based on molecular phylogenies inferred by Bayesian and Maximum Likelihood methods, using mitochondrial and nuclear DNA data. To set up a spatio-temporal framework for interpreting the evolution of this endemic Mexican lizard group, we also calculate genetic distances, estimate divergence times, and perform ecological niche modelling (ENM) for the lineages consistently recovered in the inferred phylogenies. Additionally, we analyze a series of morphometric and scutellation characteristics, using both Principal Component Analysis (PCA) and non-Metric Multidimensional Scaling (nMDS), in order to identify significant differences between lineages.
With this revision we aim to solve one of the oldest taxonomic problems in Mexican herpetology, while providing useful data that may be applied for species conservation efforts.
Since its original description, the taxonomy of S. torquatus has been problematic (
Originally, the genus Sceloporus was erected by
Syntypes of Sceloporus torquatus, Zoologisches Museum Berlin, now Museum für Naturkunde Berlin, (ZMB) 628–630, collected by Ferdinand Deppe and Alexander von Sack in Mexico (circa 1825). ZMB 628, ♂ adult; ZMB 629, ♂ adult; ZMB 630, ♀ adult; ZMB 631, ♂ adult. For all cases scale bar 20mm. Photographs courtesy of F. Tillack.
A year after
Later,
Almost 50 years later,
Several years later, another subspecies, Sceloporus torquatus mikeprestoni Smith and Álvarez, 1974 (holotype: MCZ R115679; paratypes: Escuela Nacional de Ciencias Biológicas, ENCB 5756–5763) was described from specimens collected in “Marcela, Tamaulipas”.
Finally, the subspecies Sceloporus torquatus madrensis
In total we measured 684 specimens (Table
We georeferenced all localities using GoogleEarth Pro v.7.3.3.7699 and digitized topographic maps available in the digital library of the Instituto Nacional de Estadística y Geografía (INEGI, https://www.inegi.org.mx/app/mapas). In the field we used a Garmin etrex30 GPS with WGS84 datum to record collection localities.
Number of examined and measured specimens. Measured specimens are those specimens measured for morphometrics and/or scutellation. Examined specimens are those specimens examined directly in collections or by photos to confirm identify and contribute to delimiting the geographic distribution patterns of the S. torquatus complex, but were not measured for morphometrics and/or scutellation. Other specimens include those specimens redetermined as different species.
| Taxa | Examined | Measured | |
| Morphometrics | Scutellation | ||
| S. t. torquatus | 206 | 249 | 279 |
| S. t. melanogaster | 273 | 226 | 235 |
| S. t. binocularis | 3 | 5 | 13 |
| S. t. mikeprestoni | 1 | 12 | 21 |
| S. t. madrensis north | 1 | 21 | 27 |
| S. t. madrensis south | 23 | 28 | 31 |
| Sceloporus sp. | 6 | 10 | 15 |
| Sceloporus sp. Zacatecas | 9 | 25 | 17 |
| Type material | 21 | 6 | 6 |
| Other specimens | 32 | 0 | 0 |
For genetic analyses, we obtained 56 tissue samples from the MZFC collection and field work, that include individuals collected in close proximity to the type localities of all five recognized subspecies of S. torquatus, as well as the undescribed Sceloporus sp. from western Mexico sensu
To perform DNA extractions, we used the Qiagen™ DNeasy Blood & Tissue Kit™ following the manufacturer’s protocol.
We amplified fragments of the 12S and ND4 mtDNA regions, and RAG1 of nDNA by means of polymerase chain reaction (PCR) under the following standardized conditions: 1μL DNA extraction, 9.45μL dH2O, 3μL 5X MyTaq™ Reaction Buffer, 0.5µL Primer F [10µM], 0.5µL Primer R (10µM) and 0.15µL MyTaq™ Bioline™ (5U). PCRs were carried out in a Multigene Optimax LabNet™ thermocycler with the following annealing temperatures for each molecular marker: 45°C, 12S; 54°C, ND4; and 50°C, RAG1. The oligonucleotides sequences used (Table
We used the sequencing service of the Laboratorio Nacional de Biodiversidad (LANABIO) at the Instituto de Biología (IBUNAM), which uses the BigDye Terminator v.3.1 Applied Biosystems kit and a final purification with Sephadex G-50 before analyzing cycle sequencing product on an Applied Biosystems 3730 xL DNA Analyzer Sequencer.
| Gene | Name: Sequence (5’–3’) | Source |
| 12S | L1091rRNA12S: CAAACTGGATTAGATACCCCACTAT |
|
| H1478rRNA12S: AGGGTGACGGGCGGTGTGT | ||
| ND4 | ND4: TGACTACCAAAAGCTCATGTAGAAGC |
|
| TLeu2b: TRCTTTTACTTGGATTTGCACCA | ||
| RAG1 | JRAG1f2: CAAAGTRAGATCACTTGAGAAGC |
|
| JRAG1r3: ACTTGYAGCTTGAGTTCTCTCTTAGRCG |
Once sequences were obtained, we used MUSCLE (
We constructed two molecular data matrices —the first one exclusively with the mtDNA data (12S + ND4) and the second with the combined data from mtDNA + nDNA (12S + ND4 + RAG1). We also included sequence data generated in previous works (
To infer the phylogenetic relationships of S. torquatus ssp. we performed both Bayesian inference and ML analyses with both mitochondrial and combined datasets, using MrBayes v.3.2.7a (
We used Tracer v.1.7.1. (
Genetic distances were calculated using the concatenated matrix of mtDNA data (12S + ND4). Using MEGA X v.10.0.5 (
We estimated divergence times between lineages using BEAST v2.5.1 (
We performed a series of statistical analyses to evaluate the multivariate niche overlap between lineages in the environmental spaces. We used the “PCA-env” approach (
Then, ensembles were transferred to past climate change scenarios from the paleoclimatic database PaleoClim (
We tested whether those lineages recovered by molecular phylogenetic analyses exhibit morphological differences through PCA and nMDS methods using morphometric and scutellation characters.
We followed
We measured 576 individuals exceeding 70mm SVL snout-vent length as S. torquatus reaches sexual maturity at this body size (
We removed the effect of body size on morphometric variables following
Alternatively, with the scutellation data matrix we implemented a non-Metric Multidimensional Scaling (nMDS) analysis with the Manhattan coefficient to calculate total differences of the measured variables between individuals of each recovered lineage.
We carried out these statistical analyzes with the tools provided in PAST v.4.01 (
We discovered that more than one species is represented in the type series of S. torquatus (Fig.
Additionally, we re-determined the specimen ZMB 630, a syntype of S. torquatus, as S. t. melanogaster by having undivided supraocular scales, 30 dorsal scales, 41 ventral scales, diffuse dark nuchal collar interrupted by dorsolateral light bands or marks, as well as a series of dark irregular spots that fade over the base of the tail.
Finally, we found that specimen ENCB 5756, a paratype of S. t. mikeprestoni, actually pertains to Sceloporus minor Cope, 1885. This specimen has divided supraocular scales, 36 dorsal scales, 40 scales around the body, and 44 ventral scales.
We obtained 170 sequences from the 12S (321–351 bp), ND4 + adjacent tRNA (553–719 bp), and RAG1 (909 bp) regions. The mitochondrial data matrix contains 60 samples, 1070 bp, 770 conserved sites, 300 variable sites, and 196 parsimony informative sites, while the combined data matrix contains 50 individuals, 1979 bp, with 1639 conserved sites, 350 variable sites, and 205 parsimony informative sites.
The optimal partitioning schemes of the mitochondrial and combined data sets, as well as the best substitution model for each partition, are shown in Table
| Data | Partitions | Models | |
| Bayesian | ML | ||
| 12S + ND4 | Subset1 = 1-351 354-983\3 984-1070 |
GTR+I+Γ |
GTRGAMMA |
| Subset2 = 352-983\3 | |||
| Subset3 = 353-983\3 | |||
| 12S + ND4 + RAG1 | Subset1 = 1-351 352-983\3 354-983\3 984-1070 1071-1979\3 1072-1979\3 1073-1979\3 | ||
| Subset2 = 353-983\3 | GTR+Γ | ||
Mitochondrial gene trees resulting from the Bayesian and ML analyses maintain a similar topology (Fig.
In both mitochondrial trees, S. t. torquatus, S. t. binocularis, S. t. mikeprestoni, S. t. madrensis north, and S. t. madrensis south forms a clade sister to the clade including Sceloporus sp. and Sceloporus sp. Zacatecas.
Combined mitochondrial and nuclear data phylogenies (Fig.
We consistently recovered S. bulleri and S. mucronatus as the sister species of the S. torquatus complex, while S. grammicus is sister to all of them.
The genetic distance between S. bulleri and any member of the S. torquatus complex ranges from 0.069–0.085. The genetic distance between S. t. torquatus and S. t. melanogaster is 0.054, between S. t. binocularis and S. t. mikeprestoni is 0.025, between S. t. madrensis north and S. t. madrensis south is 0.045, and that between Sceloporus sp. and Sceloporus sp. Zacatecas is 0.032 (Table
Genetic distances between taxa, calculated using the Kimura 2-parameters model for the combined mitochondrial data.
| Taxa | S. bulleri | S. t. torquatus | S. t. melanogaster | S. t. binocularis | S. t. madrensis North | S. t. madrensis South | Sceloporus sp. | Sceloporus sp. Zacatecas |
| S. bulleri | ||||||||
| S. t. torquatus | 0.074 | |||||||
| S. t. melanogaster | 0.069 | 0.054 | ||||||
| S. t. binocularis | 0.083 | 0.045 | 0.058 | |||||
| S. t. mikeprestoni | 0.084 | 0.041 | 0.059 | 0.025 | ||||
| S. t. madrensis north | 0.082 | 0.051 | 0.055 | 0.046 | 0.043 | |||
| S. t. madrensis south | 0.085 | 0.042 | 0.059 | 0.041 | 0.039 | 0.045 | ||
| Sceloporus sp. | 0.072 | 0.057 | 0.044 | 0.062 | 0.062 | 0.064 | 0.066 | |
| Sceloporus sp. Zacatecas | 0.071 | 0.062 | 0.059 | 0.067 | 0.063 | 0.063 | 0.062 | 0.032 |
The BEAST time-tree recovered a similar topology and support values to the RAxML and MrBayes trees (Fig.
In general, there are no similarities in ecological niches of each lineage within the S. torquatus complex (Table
Potential distribution models (Fig.
| sp. 1/sp. 2 | S. t. torquatus | S. t. melanogaster | S. t. binocularis | S. t. mikeprestoni | S. t. madrensis north | S. t. madrensis south | Sceloporus sp. | Sceloporus sp. Zacatecas |
| S. t. torquatus | ||||||||
| S. t. melanogaster | 0.18 | |||||||
| S. t. binocularis | 0.10 | 0.44 | ||||||
| S. t. mikeprestoni | 0.05 | 0.02 | 0.10 | |||||
| S. t. madrensis north | 0.01 | 0.04 | 0.01 | 0.00 | ||||
| S. t. madrensis south | 0.29 | 0.35 | 0.12 | 0.21 | 0.01 | |||
| Sceloporus sp. | 0.06 | 0.18 | 0.10 | 0.01 | 0.08 | 0.08 | ||
| Sceloporus sp. Zacatecas | 0.02 | 0.13 | 0.11 | 0.00 | 0.00 | 0.00 | 0.00 |
According to models projected into the past, the HSA have been very dynamic as they have expanded and contracted consecutively since the late Pliocene, but have remained associated with the main mountainous regions of central and northern Mexico. Between the mid-Pliocene Warm period (~3.2 mya) and MIS19 (~787 kya) another HSA appears in Northeast Mexico. Through the different temporal scenarios, except for the mid-Pliocene Warm, an extensive HSA has been maintained in central Mexico (Fig.
A summary of the descriptive statistics for each taxa is shown in supplementary file 5: Geographic distribution, morphometrics and scutellation of the S. torquatus complex.
We performed a PCA and nMDS analyses to contrast the morphology of the S. torquatus complex members. There is not clear segregation of the analyzed datasets (Figs
In the PCA (Fig.
The nMDS analysis (Fig.
According to the International Code of Zoological Nomenclature (ICZN; The International Trust for Zoological Nomenclature 1999) the fixation of a type specimen serves as an objective reference for the application of the taxonomic name it carries (Art. 61.1), and such objectivity is hierarchically continuous from the species level to the family level (Art. 61.1.2). Now, if in the original description of a nominal taxon a specimen or specimens bearing the name was not designated, it is possible that such a designation was made later by the figure of the first reviewer (Arts. 24.2.1). In this context,
In the other case, misidentification of the S. t. mikeprestoni paratype ENCB 5756 in the original description (
This study includes genetic data from S. t. mikeprestoni and S. t. madrensis for the first time ever, as well as the most extensive sampling throughout the distribution of the S. torquatus complex, to accomplish the most complete molecular phylogeny of this emblematic group of phrynosomatid lizards to date. The S. torquatus complex is a monophyletic group composed of eight independent lineages, five of which represent recognized subspecies, while the remaining three represent unnamed taxa that are awaiting descriptions (Flores-Villela et al. in prep.).
There is evidence to recognize the southern populations of S. t. madrensis as an independent lineage, previously confused with S. t melanogaster and S. t. madrensis (
In addition, we confirm the existence of another cryptic species from western Mexico suggested by
Additional tissue samples from the northernmost populations of S. t. melanogaster could help elucidate phylogenetic relationships within the S. torquatus complex as a sister taxon of Sceloporus spp. from Nayarit, Jalisco and Zacatecas, and could also solve phylogenetic relationships within the lineage S. t. melanogaster. Future samplings along the contact zone of S. t. torquatus and S. t. melanogaster in central Mexico would be useful to determine the extent of gene flow, and to investigate mechanisms of reproductive isolation, especially since behavior and coloration are known to be related to conspecific recognition and reproductive success in Sceloporus (
At the end of the Neogene, tectonic and volcanic activity gave rise to the main mountain systems of Mexico, promoting vicariant events in numerous taxa (
The modeled HSA (Fig.
Although the niche similarity test that we performed is not conclusive (Table
It has been suggested that morphological convergence may be related to environmental similarity in other species of the torquatus group (
As we expected due to its inherent properties, the mtDNA showed higher genetic differentiation than the nDNA and largely drove the phylogeographic patterns discussed above. While we acknowledge the limitations of using solely or mainly mtDNA for species delimitation (
With all available evidence examined herein, we conclude that S. torquatus represents a multi-faceted taxonomic problem. We identified several different taxa in the syntype series of S. torquatus, and discovered a greater diversity than currently recognized within the complex that is masked by recently diverged cryptic species.
For nomenclature to reflect the phylogenetic relationships in the S. torquatus complex, we recommend the following taxonomic changes: the reassignment of S. t. melanogaster (= S. melanogaster) and S. t. binocularis (= S. binocularis) to species level, and the use of the new combinations S. mikeprestoni comb. nov. and S. madrensis comb. nov. These changes allow S. torquatus to be monotypic.
Those populations from southern San Luis Potosí, northeastern Querétaro and northern Hidalgo represent a distinct species that has previously been confused with both S. t. torquatus and S. t. madrensis. Similarly, populations from eastern Zacatecas, previously considered as S. t. melanogaster, represent another unnamed species. Formal descriptions for both will be published separately, including expanded sampling in northern, western, and central Mexico to investigate phylogeographic structure and gene flow between neighboring species (Flores-Villela et al. in prep.).
To curators and curatorial staff for data and photographs of the specimens under their custody: David A. Kizirian, Lauren Vonnahme (American Museum of Natural History, AMNH), Ned Gilmore (Academy of Natural Sciences of Philadelphia, ANSP), Alison Whiting (Brigham Young University, BYU), Lauren Scheinberg, Erica Ely (California Academy of Sciences, CAS), Uriel Hernández Salinas (Centro Interdisciplinario de Investigación para el Desarrollo Integral Regional, Unidad Durango, CRD), Stephen Rogers, Stevie Kennedy-Gold (Carnegie Museum of Natural History, CM), Víctor Hugo Reynoso Rosales, Omar Hernández Ordoñez (Colección Nacional de Anfibios y Reptiles, CNAR), Juan Carlos López Vidal†, Cynthia Elizalde Arellano (Escuela Nacional de Ciencias Biológicas, ENCB), Alan Resetar, Joshua Mata (Field Museum of Natural History, FMNH), Max Alan Nickerson, Coleman M. Sheehy (Florida Museum of Natural History, FLMNH), Rafe Brown, Melissa Mayhew, Ana Paula Motta Vieira (Kansas University, KU), Leticia Ochoa Ochoa, Adrián Nieto Montes de Oca (Museo de Zoología Alfonso L. Herrera, MZFC), Frank Tillack (Museum für Naturkunde Berlin, ZMB); James Hanken, Jose Rosado, Joseph Martinez (Museum of Comparative Zoology, MCZ), David Marques (Naturhistorisches Museum Basel, NMB), Toby Hibbitts (Texas Cooperative Wildlife Collection, TCWC), Texas Natural History Collection, TNHC), David Lazcano Villareal (Universidad Autónoma de Nuevo León, UANL); James Poindexter, Addison Wynn, (United States National Museum, USNM), Chris Phillips, Daniel Brian Wylie (University of Illinois Museum of Natural History, UIMNH). To Irene Goyenechea Mayer, Daniel Piñero, Livia S. León, Marisol Motellano, Andrés García, Lázaro Guevara, Carlos Pedraza, Israel Solano, Luis F. Vázquez, Ricardo Palacios, Ricardo Rivera, Gonzalo Medina, Rufino Santos, Luis Canseco, Atziri A. Ibarra, Carlos A. Hernández, Mauricio Tepos, Sol de Mayo Mejénez, Sergio Terán, Alfredo Sánchez, María L. Ochoa for their invaluable assistance in carying out this work. To the Secretaría del Medio Ambiente y Recursos Naturales (SEMARNAT) for issuing collecting permits to OFV FAUT-0015, and LMOO FAUT-0317. To the staff of Rancho del Cielo and El Cielo Biosphere reserve, Jean L. Lacaille and Martha López. To the staff of Laboratorio Nacional de Biodiversidad (LaNaBio) Laura M. Márquez and Nelly M. López. To the UNAM Postgraduate Program (Posgrado en Ciencias Biológicas). To grant no. PAPIIT-IN216218, from UNAM. To first author, this work constitutes a requirement for obtaining the degree of Master in Biological Sciences of the Posgrado en Ciencias Biológicas, Sistemática, UNAM. GCG and BOB were supported by a CONACYT fellowship (CVU 856512 and 929090, respectively). JAVV was supported by a postdoctoral fellowship from DGAPA-UNAM.
Specimens and localities
Data type: .docx
Explanation note: Museum specimens and localities.
Specimen vouchers
Data type: .xlsx
Explanation note: Specimen vouchers and genetic sequences.
Morphometric measurements
Data type: .xlsx
Explanation note: Morphometric measurements.
Scalation counts
Data type: .xlsx
Explanation note: Scalation counts.
Statistics
Data type: .docx
Explanation note: Morphometric and scalation statistics.
Morphometric statistics
Data type: .xlsx
Explanation note: Morphometric statistics.