Research Article |
Corresponding author: Ishan Agarwal ( ishan.agarwal@gmail.com ) Academic editor: Uwe Fritz
© 2024 Ishan Agarwal, Tejas Thackeray, Akshay Khandekar.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Agarwal I, Thackeray T, Khandekar A (2024) A non-adaptive radiation of viviparous skinks from the seasonal tropics of India: Systematics of Subdoluseps (Squamata: Scincidae), with description of a new genus and five cryptic new species. Vertebrate Zoology 74: 23-83. https://doi.org/10.3897/vz.74.e110674
|
Abstract
Subdoluseps is a recently described genus of Lygosomine skinks distributed in peninsular India and Southeast Asia. We conduct the first revision of Indian Subdoluseps based on range-wide sampling including 89 specimens from 33 localities. We use two mitochondrial and three nuclear markers, 58 morphological characters, and ecological data to reconstruct the evolutionary history of Indian Subdoluseps and assess their diversity and distribution, providing insights into lygosominin biogeography. We formally describe the Indian clade as a new genus, Dravidoseps gen. nov. and name five new species from Tamil Nadu, India in an integrative taxonomic framework – D. gingeeensis sp. nov., D. jawadhuensis sp. nov., D. kalakadensis sp. nov., D. srivilliputhurensis sp. nov., and D. tamilnaduensis sp. nov.. We transfer Riopa goaensis, Subdoluseps pruthi and S. nilgiriensis to the new genus and designate neotypes for the former two. Members of Dravidoseps gen. nov. are the first known viviparous skinks from peninsular India and the only known viviparous lygosominins apart from a few species of east African Mochlus. The Lygosomini have a Southeast Asian origin and began diversifying in the Eocene with three dispersals between India and Southeast Asia. Species level diversification in Dravidoseps gen. nov. was likely driven by a combination of niche conservatism, paleoclimate and past forest distribution. The discovery of a new genus and five new species reiterates the high levels of diversity and endemism present in peninsular India and how much more remains to be discovered.
Asia, biodiversity hotspot, diversification, integrative taxonomy, nuclear DNA, reproductive mode
Skinks (Family Scincidae) are among the most diverse squamate clades, with over 1,740 species distributed across tropical and temperate regions, from sea level up to over 4,500 m (
Peninsular India has a moderate species diversity of skinks with ~40 species including representatives of two of the three global skink sub-families and numerous endemic radiations at the genus or clade level (
The genus Subdoluseps (type species: Eumeces bowringii Günther) was recently erected for species formerly assigned to Lygosoma Hardwicke and Gray, which molecular phylogenetic data places sister to Riopa from India and Southeast Asia and Mochlus Günther from Africa, within the Tribe Lygosomini (
Elevation map showing sampling localities from peninsular India. Stars indicate type localities (neotype locality shown for Dravidoseps goaensis comb. nov., original type locality is close to the southernmost point), light blue D. jawadhuensis sp. nov., dark blue D. srivilliputhurensis sp. nov., light green D. kalakadensis sp. nov., dark green D. pruthi comb. nov., red D. gingeeensis sp. nov., yellow D. nilgiriensis comb. nov., pink D. tamilnaduensis sp. nov., and grey, D. sp. Kalrayan (colour scheme representing species is the same as Figs
The vast landscape that Subdoluseps is distributed in across peninsular India is highly heterogeneous, including the biodiverse Western Ghats and several isolated massifs and uplands. All of these landscapes harbour numerous endemic species and lineages of agamids, geckos and skinks from multiple genera (e.g.
We sampled most reported peninsular Indian localities of Subdoluseps spp. (
We sequenced 57 Subdoluseps tissues from 33 localities (the sample from Kalrayan is a tail-tip only, some others were juveniles or damaged individuals – listed in referred material) across the known range of the group in peninsular India (Fig.
Sequences used in this study with voucher and locality information. Voucher collection abbreviations as follows: AK/AK-R Akshay Khandekar field series; BNHS, Bombay Natural History Society, Mumbai; CAS, California Academy of Sciences, San Francisco; CES, Centre for Ecological Sciences, Bangalore; FMNH, Field Museum of Natural History, Gainesville; JAM, Jimmy McGuire field series; KU, University of Kansas Natural History Museum, Lawrence; LSUH, La Sierra University, Riverside, California; MVZ, Museum of Vertebrate Zoology, Berkeley; NRC, National Centre for Biological Sciences, Bangalore; PEMR, Port Elizabeth Museum, Port Elizabeth; ZMKUR, ZSI-R, Zoological Survey of India, Kolkata.
Species | Voucher | Locality | GenBank accession number | ||||
---|---|---|---|---|---|---|---|
16S | ND2 | PRLR | R35 | RAG1 | |||
Dravidoseps pruthi comb. nov. | NRC-AA-1292 (AK803) | India: Tamil Nadu, Dharmapuri District, Sitteri | OR886462 | OR888556 | OR888610 | OR888646 | OR888678 |
Dravidoseps pruthi comb. nov. | NRC-AA-1293 (AK804) | India: Tamil Nadu, Dharmapuri District, Sitteri | OR886463 | OR888557 | OR888611 | OR888647 | OR888679 |
Dravidoseps pruthi comb. nov. | BNHS 2525 (AK-R 2197) | India: Tamil Nadu, Salem District, Palamalai | OR886464 | OR888558 | OR888612 | OR888648 | OR888680 |
Dravidoseps pruthi comb. nov. | BNHS 2557 (AK-R 2198) | India: Tamil Nadu, Salem District, Palamalai | OR886465 | OR888559 | / | / | / |
Dravidoseps pruthi comb. nov. | AK-R 2199 | India: Tamil Nadu, Salem District, Palamalai | OR886466 | OR888560 | OR888613 | OR888648 | OR888681 |
Dravidoseps pruthi comb. nov. | AK-R 2213 | India: Tamil Nadu, Dharmapuri District, Sitteri | OR886467 | OR888561 | / | / | / |
Dravidoseps pruthi comb. nov. | NRC-AA-1291 (AK-R 2222) | India: Tamil Nadu, Dharmapuri District, Sitteri | OR888562 | OR888614 | OR888649 | OR888682 | |
Dravidoseps pruthi comb. nov. | ZSI-R-28601 (AK-R 2716) | India: Tamil Nadu, Salem District, Vanavasi RF | OR886468 | OR888563 | / | / | / |
Dravidoseps pruthi comb. nov. | ZSI-R-28602 (AK-R 2750) | India: Tamil Nadu, Salem District, N slope of Yercaud | OR886469 | OR888564 | OR888615 | OR888650 | OR888683 |
Dravidoseps goaensis comb. nov. | NRC-AA-1303 (AK 1052) | India: Maharashtra, Kolhapur District, nr. Ugwai temple | / | OR888565 | // | // | // |
Dravidoseps goaensis comb. nov. | NRC-AA-1304 (AK 1190) | India: Maharashtra, Kolhapur District, Talaye | / | OR888566 | / | / | / |
Dravidoseps goaensis comb. nov. | NRC-AA-1305 (AK 1300) | India: Maharashtra, Kolhapur District, Pandivare | OR886470 | OR888567 | OR888616 | OR888651 | OR888684 |
Dravidoseps goaensis comb. nov. | BNHS 2566 (AK 1303) | India: Maharashtra, Kolhapur District, Kapurkada Falls, Washi | OR886471 | OR888568 | / | / | / |
Dravidoseps goaensis comb. nov. | BNHS 2567 (AK 1345) | India: Maharashtra, Sindhudurg District, Amboli | OR886472 | OR888569 | OR888617 | OR888652 | OR888685 |
Dravidoseps goaensis comb. nov. | NRC-AA-1302 (AK-R 2808) | India: Goa, South Goa District, Ustam | / | OR888570 | OR888618 | OR888653 | / |
Dravidoseps goaensis comb. nov. | ZSI-R 28612 (AK-R 847) | India: Maharashtra, Sindhudurg District, Amboli | / | OR888571 | OR888619 | / | OR888686 |
Dravidoseps nilgiriensis comb. nov. | BNHS 2642 | India: Tamil Nadu, Coimbatore District, Anaikatti hills | MW353683 | / | / | / | / |
Dravidoseps nilgiriensis comb. nov. | NRC-AA-1295 (AK-R 1854) | India: Tamil Nadu, Dindigul District, Palani Hills, nr. Mangalamkombu | OR886473 | OR888572 | OR888620 | OR888654 | OR888687 |
Dravidoseps nilgiriensis comb. nov. | NRC-AA-1296 (AK-R 1877) | India: Tamil Nadu, Dindigul District, Palani Hills, nr. Mangalamkombu | OR886474 | OR888573 | / | / | / |
Dravidoseps nilgiriensis comb. nov. | NRC-AA-1297 (AK-R 2022) | India: Tamil Nadu, Coimbatore District, ATR, Aliyar RF | OR886475 | OR888574 | OR888621 | OR888655 | OR888688 |
Dravidoseps nilgiriensis comb. nov. | NRC-AA-1298 (AK-R 2023) | India: Tamil Nadu, Coimbatore District, ATR, Aliyar RF | OR886476 | OR888575 | / | / | / |
Dravidoseps nilgiriensis comb. nov. | NRC-AA-1299 (AK-R 2080) | India: Tamil Nadu, Coimbatore District, near Mettupalayam | OR886477 | OR888576 | OR888622 | OR888656 | OR888689 |
Dravidoseps nilgiriensis comb. nov. | NRC-AA-1300 (AK-R 2081) | India: Tamil Nadu, Coimbatore District, near Mettupalayam | OR886478 | OR888577 | / | / | / |
Dravidoseps nilgiriensis comb. nov. | NRC-AA-1301 (AK-R 2172) | India: Tamil Nadu, Erode District, Thamarakarai | OR886479 | OR888578 | OR888623 | OR888657 | OR888690 |
Dravidoseps nilgiriensis comb. nov. | (AK-R 2173) | India: Tamil Nadu, Erode District, Thamarakarai | OR886480 | OR888579 | / | / | / |
Dravidoseps nilgiriensis comb. nov. | BNHS 2559 (AK-R 2539) | India: Tamil Nadu, Madurai District, Sirumalai Hills, nr. Kutladampatti Falls | / | OR888580 | OR888624 | OR888658 | OR888691 |
Dravidoseps nilgiriensis comb. nov. | BNHS 2560 (AK-R 2540) | India: Tamil Nadu, Madurai District, Sirumalai Hills, nr. Kutladampatti Falls | OR886481 | OR888581 | / | / | / |
Dravidoseps nilgiriensis comb. nov. | BNHS 2564 (AK-R 2585) | India: Tamil Nadu, Dindigul District, Karanthamalai Hills | OR886482 | OR888582 | OR888625 | OR888659 | OR888692 |
Dravidoseps nilgiriensis comb. nov. | BNHS 2565 (AK-R 2586) | India: Tamil Nadu, Dindigul District, Karanthamalai Hills | OR886483 | OR888583 | / | / | / |
Dravidoseps nilgiriensis comb. nov. | ZSI-R-28604 (AK-R 2667) | India: Tamil Nadu, Coimbatore District, ATR, Perunguntru trek | OR886484 | OR888584 | OR888626 | OR888660 | OR888693 |
Dravidoseps nilgiriensis comb. nov. | ZSI-R-28605 (AK-R 2668) | India: Tamil Nadu, Coimbatore District, ATR, Perunguntru trek | OR886485 | OR888585 | / | / | / |
Dravidoseps nilgiriensis comb. nov. | ZSI-R-28694 (AK-R 2726) | India: Tamil Nadu, Namakkal District, Kolli Hills | / | OR888586 | OR888627 | OR888661 | OR888694 |
Dravidoseps gingeeensis sp. nov. | NRC-AA 8273 (AK-R 147) | India: Tamil Nadu, Villupuram District, Pakkamalai RF | OR886486 | OR888587 | OR888628 | OR888662 | OR888695 |
Dravidoseps gingeeensis sp. nov. | BNHS 2568 (AK-R 192) | India: Tamil Nadu, Tiruvannamalai District, Vedal | OR886487 | OR888588 | OR888629 | OR888663 | OR888696 |
Dravidoseps jawadhuensis sp. nov. | NRC-AA 8274 (CES 09/ 930) | India: Tamil Nadu, Vellore District, Jawadhu Hills | MK414572 | / | MK409470 | / | MK409548 |
Dravidoseps jawadhuensis sp. nov. | BNHS 2569 (AK 850) | India: Tamil Nadu, Vellore District, Jawadhu Hills | OR886488 | OR888589 | OR888630 | OR888664 | OR888697 |
Dravidoseps kalakadensis sp. nov. | NRC-AA 8276 (AK-R 605) | India: Tamil Nadu, Tirunelveli District, KMTR | OR886489 | OR888590 | OR888631 | OR888665 | OR888698 |
Dravidoseps kalakadensis sp. nov. | NRC-AA 8277 (AK-R 606) | India: Tamil Nadu, Tirunelveli District, KMTR | OR886490 | / | OR888632 | OR888666 | OR888699 |
Dravidoseps kalakadensis sp. nov. | BNHS 2830 (AK-R 700) | India: Tamil Nadu, Tirunelveli District, KMTR | OR886491 | OR888591 | OR888633 | OR888667 | OR888700 |
Dravidoseps kalakadensis sp. nov. | BNHS 2831 (AK-R 701) | India: Tamil Nadu, Tirunelveli District, KMTR | / | / | OR888634 | / | OR888701 |
Dravidoseps srivilliputhurensis sp. nov. | NRC-AA 8279 (AK-R 1344) | India: Tamil Nadu, Virudhunagar District, SMTR, Ayyanar Kovil Falls | OR886492 | OR888592 | OR888635 | OR888668 | OR888702 |
Dravidoseps srivilliputhurensis sp. nov. | NRC-AA 8281 (AK-R 1345) | India: Tamil Nadu, Virudhunagar District, SMTR, Ayyanar Kovil Falls | OR886493 | OR888593 | / | / | / |
Dravidoseps srivilliputhurensis sp. nov. | BNHS 2832 (AK-R 1434) | India: Tamil Nadu, Virudhunagar District, SMTR | OR886494 | OR888594 | OR888636 | OR888669 | OR888703 |
Dravidoseps srivilliputhurensis sp. nov. | BNHS 2833 (AK-R 1435) | India: Tamil Nadu, Virudhunagar District, SMTR | OR886495 | OR888595 | / | / | / |
Dravidoseps srivilliputhurensis sp. nov. | BNHS 2836 (AK-R 1489) | India: Tamil Nadu, Virudhunagar District, SMTR, Atthi Kovil | OR886496 | OR888596 | OR888637 | OR888670 | OR888704 |
Dravidoseps srivilliputhurensis sp. nov. | BNHS 2837 (AK-R 1490) | India: Tamil Nadu, Virudhunagar District, SMTR, Atthi Kovil | OR886497 | OR888597 | / | / | / |
Dravidoseps srivilliputhurensis sp. nov. | ZSI-R-28617 (AK-R 1516) | India: Tamil Nadu, Theni District, SMTR, Sathuragiri | OR886498 | OR888598 | OR888638 | OR888671 | OR888705 |
Dravidoseps srivilliputhurensis sp. nov. | ZSI-R-28618 (AK-R 1716) | India: Tamil Nadu, Theni District, SMTR, Chinna Suruli Falls | OR886499 | OR888599 | / | / | / |
Dravidoseps srivilliputhurensis sp. nov. | (AK-R 1717) | India: Tamil Nadu, Theni District, SMTR, Chinna Suruli Falls | OR886500 | OR888600 | OR888639 | OR888672 | OR888706 |
Dravidoseps srivilliputhurensis sp. nov. | ZSI-R-28619 (AK-R 1761) | India: Tamil Nadu, Theni District, SMTR, Megamalai View Point | OR886501 | OR888601 | / | / | / |
Dravidoseps srivilliputhurensis sp. nov. | ZSI-R-28620 (AK-R 1762) | India: Tamil Nadu, Theni District, SMTR, Megamalai View Point | OR886502 | OR888602 | / | / | / |
Dravidoseps tamilnaduensis sp. nov. | NRC-AA 8287 (AK 739) | India: Tamil Nadu, Tiruchirappalli District, Pachaimalai | OR886503 | OR888603 | OR888640 | OR888673 | OR888707 |
Dravidoseps tamilnaduensis sp. nov. | NRC-AA 8288 (AK 740) | India: Tamil Nadu, Tiruchirappalli District, Pachaimalai | OR886503 | OR888604 | OR888641 | OR888674 | OR888708 |
Dravidoseps tamilnaduensis sp. nov. | NRC-AA 8286 (AK-R 2396) | India: Tamil Nadu, Tiruchirappalli District, Pachaimalai | OR886504 | OR888605 | OR888642 | / | / |
Dravidoseps tamilnaduensis sp. nov. | ZSI-R-28692 (AK-R 2724) | India: Tamil Nadu, Namakkal District, Kolli Hills | / | OR888606 | OR888643 | OR888675 | OR888709 |
Dravidoseps tamilnaduensis sp. nov. | ZSI-R-28693 (AK-R 2725) | India: Tamil Nadu, Namakkal District, Kolli Hills | OR886505 | OR888607 | / | / | / |
Dravidoseps tamilnaduensis sp. nov. | ZSI-R-28695 (AK-R 2734) | India: Tamil Nadu, Salem District, nr. Madu Falls | OR886506 | OR888608 | OR888644 | OR888676 | OR888710 |
Dravidoseps sp. Kalrayan | AK-R 2379 (tissue sample only) | India: Tamil Nadu, Villupuram District, Kalrayan Hills | OR886507 | OR888609 | OR888645 | OR888677 | OR888711 |
Subdoluseps bowringii | FMNH 261839 | Cambodia | MK414544 | MK414544 | MK409442 | MK409498 | MK409526 |
Subdoluseps bowringii | JAM 1893 | Malaysia | / | JQ610822 | / | / | / |
Subdoluseps frontoparietalis | ZMKUR 705 | Thailand | / | / | MK409454 | MK409509 | MK409539 |
Subdoluseps malayana | LSUHC 12098 | Malaysia | MG020473 | / | MK409456 | MK409514 | MK409541 |
Subdoluseps samajaya | CAS 259777 | Indonesia | MG020475 | / | MK409457 | MF981876 | MK409542 |
Eutropis dissimilis | MVZ 248450 | Pakistan | KX364958 | KX364958 | |||
Eutropis macularia | CAS 247949 | Myanmar | KX231450 | / | |||
Eutropis multifasciata | KU 337427 | Phillipines | MK414566 | MK414566 | MK409460 | MK409520 | KX231381 |
Trachylepis boulengeri | PEMR 16179 | Tanzania | / | / | / | / | MK791864 |
Trachylepis capensis | CAS 234152 | South Africa | MK792005 | MG605159 | KC345131 | ||
Trachylepis perrotetii | KU 291923 | Guinea | / | / | JF498450 | JF498450 | / |
Primers and annealing temperature used for PCR amplification and sequencing.
Gene | Primers | Sequence (5’ – 3’) | Annealing temperature | Source |
16S | 16Sar-L | CGCCTGTTTATCAAAAACAT | 50°C |
|
16Sbr-H | CCGGTCTGAACTCAGATCACGT | |||
ND2 | L4437 | AAGCTTTCGGGCCCATACC | 50°C |
|
H5540 | TTTAGGGCTTTGAAGGC | |||
PRLR | PRLR.F1 | GACARYGARGACCAGCAACTRATGCC | 53°C |
|
PRLR.R3 | GACYTTGTGRACTTCYACRTAATCCAT | |||
R35 | R35.F | GACTGTGGAYGAYCTGATCAGTGTGG | 53°C |
|
R35.R | GCCAAAATGAGSGAGAARCGCTTCTG | |||
RAG1 | RAG1SKF2 | TTCAAAGTGAGATCGCTTGAAA | 53°C |
|
RAG1SKR1200 | CCCTTCTTCTTTCTCAGCAAAA |
Uncorrected pairwise ND2 sequence divergence (below diagonal, maximum ND2 intra-lineage divergence in bold along diagonal) and number of differences in concatenated nuclear sequence data (above diagonal) between species of Dravidoseps gen. nov. and Subdoluseps bowringii.
Species | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | |
1 | D. gingeeensis sp. nov. | 1.6 | 12 | 24 | 25 | 8 | 23 | 16 | 11 | 4 |
2 | D. jawadhuensis sp. nov. | 17.0 | / | 29 | 30 | 14 | 30 | 21 | 13 | 14 |
3 | D. kalakadensis sp. nov. | 19.4 | 20.7 | 1.0 | 1 | 27 | 34 | 5 | 21 | 27 |
4 | D. srivilliputhurensis sp. nov. | 18.5 | 19.4 | 11.5 | 3.0 | 28 | 33 | 5 | 22 | 27 |
5 | D. tamilnaduensis sp. nov. | 14.1 | 14.0 | 19.5 | 18.9 | 5.0 | 28 | 18 | 14 | 5 |
6 | D. goaensis comb. nov. | 18.9 | 19.1 | 21.3 | 19.7 | 17.4 | 3.3 | 25 | 29 | 28 |
7 | D. nilgiriensis comb. nov. | 21.1 | 21.2 | 14.0 | 13.8 | 19.5 | 18.6 | 4.3 | 13 | 18 |
8 | D. pruthi comb. nov. | 14.8 | 14.7 | 18.3 | 17.9 | 14.0 | 17.1 | 19.3 | 5.1 | 12 |
9 | D. sp. Kalrayan | 14.6 | 14.5 | 19.4 | 17.9 | 10.5 | 18.6 | 19.5 | 13.7 | / |
10 | S. bowringii | 21.9 | 23.7 | 23.0 | 21.9 | 23.3 | 23.2 | 23.0 | 22.2 | 23.4 |
The monophyly of Subdoluseps, and the sister relationship between Indian and Southeast Asian Subdoluseps was well supported in previous studies (
We subset our molecular datasets for three separate analyses: the first including each marker separately, the second concatenating only nuclear data, and the third concatenating all protein-coding genes genes (ND2 + nuclear DNA). The best-fitting partitioning schemes and models of sequence evolution were calculated for each gene fragment partitioned by codon (with a single partition for 16S) in PartitionFinder 2.1.1 (
Our approach to species delimitation integrates multiple independent sources of data to demonstrate that each putative species is an independently evolving lineage (
We built median joining haplotype networks for each nuclear marker after excluding missing data with an epsilon setting of zero in Popart 1.7 (
The molecular dataset for divergence dating included a single lineage each per putative species of Indian Subdoluseps, with a relatively dense sampling of the Lygosomini (after
We extracted climate data using BIOCLIM variables (WorldClim version 2.1 climate data for 1970–2000;
We designated three ancestral areas for the Lygosomini – India (the Indian subcontinent west of Myanmar), Southeast Asia (all areas east of Myanmar), and Africa using trimmed trees from the divergence dating analysis for biogeographic analyses. Riopa albopunctata was coded as being distributed in India, where it has a wide distribution, as no sequences or voucher specimens are available to confirm records from Southeast Asia (
The morphological dataset comprises 58 characters from 89 specimens from Maharashtra and Tamil Nadu including topotypical material for S. nilgiriensis, S. pruthi and L. goaensis and the type series of S. nilgiriensis. The types of S. pruthi and R. goaensis could not be traced in the collection of the ZSIK (
Line drawing of head of Dravidoseps pruthi comb. nov. (neotype, NRC-AA-1291): A dorsal and B lateral view. Scale nomenclature is after
Meristic data recorded were ,supraoculars (SO, number of supraocular scales); ,supraoculars contacting frontoparietal (SO contacting FP, number of supraoculars in contact with frontoparietal); ,Nuchals (Nu, number of elongated scales behind parietals and between first secondary temporals, excluding smaller scales forming continuous paravertebral rows behind the parietals); ,scales between nuchals (Sb Nu, number of transverse paravertebral scales behind parietals counted between enlarged, elongated nuchals); ,supraciliary scales (SC, number of supraciliary scales counted between prefrontal and post-supraocular above eye); ,loreals (LO, number of loreal scales); ,pre-supraoculars (PrSpO, number of pre-supraoculars); ,preoculars (PrO, number of preoculars); ,pre-suboculars (PrSbO, number of pre-suboculars); ,post-supraoculars (PoSpO, number of post-supraoculars); ,postoculars (PoO, number of postoculars); ,post-suboculars (PoSbO, number of post-suboculars); ,post-supralabials (PoSL, number of scales posterior to and contacting last supralabial, excluding temporals); ,primary temporals (PT, number of primary temporals – scales behind eye and above SL) ; ,secondary temporals (ST, number of secondary temporals – scales in contact with PT but excluding PoSL); ,tertiary temporals (TT, number of tertiary temporals – scales in contact with ST excluding Nu); ,the number of supralabials and infralabials (SL and IL, from rostral and mental, respectively, to the posterior-most enlarged scale at the mouth opening; number indicated by Roman numerals); ,ear lobules (Elo, number of ear lobules); ,chin shields (CS, number of enlarged chin shields); ,paravertebral scales (PVT, number of scales between the nuchals/parietals to immediately above the cloaca counted in a straight line immediately left or right of the vertebral column); ,round the body scales (RBS, number of scales around the body counted at mid-body); ,ventral scales (VS, number of scales counted in a straight line between the first pair of chin shields to the anterior border of the cloaca); ,scales on precloacal row (SPCLR, number of enlarged scales on the last row above the cloaca counted between hindlimb insertions); ,round the tail scales (RTS, number of scales around the tail counted at the 10th subcaudal scale); ,transverse subdigital lamellae which are wider than high, counted from the base of the digits to the apical end on ,finger 1 (LamF1), ,finger 4 (LamF4), ,toe 1 (LamT1), and ,toe 4 (LamT4).
Additional categorical characters evaluated were supranasals/ prefrontals/ nuchals in contact with each other or separated, frontoparietal/ nasal divided or undivided, presence or absence of transparent disk on lower eyelid, enlarged supralabial below eye, and smooth versus keeled scales on body/ tail dorsum/ lateral sides of tail base.
We also dissected a number of specimens to determine sex and examine the presence of developing eggs/ embryos. Individuals with a yellow throat and flank colouration in life were determined to be adult males.
We cleared and stained one adult female and three subadult Indian Subdoluseps in order to determine the nature of the secondary palate (open versus closed, sensu Greer 1977) following the protocols of
We searched for diagnostic morphological characters between lineages that fulfilled the mtDNA and nucDNA species delimitation criteria (see species delimitation section above) that were represented by specimens (all lineages except the tail-tip from Kalrayan). Every locality we sampled had a single Subdoluseps mtDNA + nucDNA lineage except for the Kolli Hills (Namakkal District, Tamil Nadu), which included two. Non-genotyped specimens from all populations were assigned to their respective mtDNA lineage, except for NRCAA-8289 (AK-R 2727) from the Kolli Hills which could not be confidently assigned to a population based on morphology. We included only what we considered adults (> 70% of maximum SVL for all species or ≥ 40 mm, n = 64) for analyses of mensural data, which included the characters SVL, AGL, CL, EE, ES, HL, HW and IO. Mensural data were allometrically size-adjusted using
Analyses of the concatenated molecular dataset, with an expanded sampling of skinks, recovered a well-supported Lygosomini and a monophyletic Subdoluseps (Figs
Timetree for the Lygosominae. Numbers at nodes are median node age and bars 95 % HPD; solid black circles indicate posterior probability ≥0.99 + bootstrap support ≥ 80% and open circle posterior probability 0.97 + no bootstrap support; colored circles below nodes represent reconstructed ancestral areas and colored squares indicate distributional ranges; ovals indicate condition of the lower eyelid.
A Median joining networks of Dravidoseps gen. nov. for three nuclear markers, nodes scaled by haplotype frequency, hatch marks on connecting lines indicate mutations and black circles indicate unsampled intermediate haplotype states. B Maximum likelihood ND2 phylogeny of Dravidoseps gen. nov. with posterior probability/ bootstrap support shown at nodes (outgroups not shown) and species delimitation results shown by alternating black and grey bars with total putative species below (BC, barcoding gap; PT, PTP; MP, mPTP; PR, PRLR; RAG, RAG-1), (square bracket indicates the two separated black squares are a single species). C Histogram of uncorrected pairwise ND2 sequence divergence within Dravidoseps gen. nov. with the barcoding gap marked by an arrow. Putative species are coloured as in Figure
The Indian Subdoluseps clade includes nine lineages (Figs
Uncorrected pairwise ND2 sequence divergences between Southeast Asian and Indian Subdoluseps range from 21.9–23.7 %, and up to 21.3 % within Indian Subdoluseps. A barcoding gap is seen between 5.5–9.7 %, suggesting a total of nine putative species with sequence divergence ≥ 5.5 % (Fig.
The time of divergence between the Scincidae and the Cordyliformes was estimated at 147 (154–145) Mya, and the most recent common ancestor (MRCA) of the Scincidae at 101 (113–89) Mya (Fig. S1). The Lygosomini began diversifying 56 (64–48) Mya and the clade including Lepidothryis, Mochlus, Riopa, and Subdoluseps 44 (50–37) Mya (Fig.
Indian and Southeast Asian Subdoluseps occupy significantly different climate space based on ANOVA and Tukey HSD tests. In general, Indian Subdoluseps occur in regions with cooler average temperatures (BIO1, median 24.5°C versus 26.4°C), higher temperature seasonality and extremes, lower annual precipitation (BIO12, median 942 versus 2251) and higher precipitation seasonality, and canopy cover that ranges from 0–85 (median 33; 0–100 in Southeast Asia, median 90) (Fig.
Boxplots of climate and canopy cover for Dravidoseps gen. nov. and Subdoluseps: A temperature; B precipitation; C canopy cover (circles are mild outliers and * are extreme outliers; dashed grey line in (A) is median annual temperature); and D plot of the first three Principal Components from a PCA of size-corrected mensural data for Dravidoseps gen. nov.
The ancestral area of the Lygosomini was reconstructed as being Southeast Asia (probability 0.90), with equivocal reconstructions for the MRCA of Mochlus + Lygosoma and Indian and Southeast Asian Subdoluseps (Southeast Asia 0.46, India 0.41) and the MRCA of Indian and Southeast Asian Subdoluseps (India 0.56, Southeast Asia 0.32); while the MRCA of Mochlus + Riopa was reconstructed as being distributed in India (0.56) as was the MRCA of Riopa (0.95) (Fig.
The PCA of size-corrected mensural data showed no separation between the eight sampled lineages (the ninth lineage sp. Kalrayan was represented by a tail-tip only and is thus excluded from morphological analyses) of peninsular Indian Subdoluseps (Fig.
Summary of maximum SVL (mm) and meristic data for the eight lineages of Dravidoseps gen. nov..
D. gingeeensis sp. nov. | D. jawadhuensis sp. nov. | D. kalakadensis sp. nov. | D. srivilliputhurensis sp. nov. | D. tamilnaduensis sp. nov. | D. goaensis comb. nov. | D. nilgiriensis comb. nov. | D. pruthi comb. nov. | |
SVL | 56.6 | 46.6 | 56.0 | 55.6 | 55.2 | 55.2 | 57.1 | 56.0 |
n | 2 | 2 | 10 | 20 | 12 | 7 | 25 | 10 |
PVS | ||||||||
mean ± SD | 66.5 ± 0.71 | 65.5 ± 0.71 | 64.6 ± 0.97 | 64.5 ± 1.05 | 68.0 ± 1.48 | 64.1 ± 1.95 | 65.0 ± 2.03 | 66.7 ± 2.00 |
range (n) | 66–67 (2) | 65–66 (2) | 63–66 (10) | 63–66 (20) | 66–70 (12) | 62–67 (7) | 62–70 (25) | 64–69 (10) |
RBS | ||||||||
mean ± SD | 31.0 ± 1.41 | 31.0 ± 1.41 | 28.0 ± 0.00 | 27.8 ± 0.79 | 29.6 ± 0.79 | 29.0 ± 1.00 | 28.1 ± 0.86 | 30.0 ± 0.00 |
range (n) | 30–32 (2) | 30–32 (2) | 28 (10) | 26–29 (20) | 28–30 (12) | 28–30 (7) | 26–30 (25) | 30 (10) |
LAM4T | ||||||||
mean ± SD | 17.0 ± 0.00 | 16.5 ± 0.71 | 14.9 ± 0.57 | 14.8 ± 0.97 | 13.7 ± 1.07 | 13.4 ± 0.79 | 14.4 ± 0.76 | 16.1 ± 1.20 |
range (n) | 17 (2) | 16–17 (2) | 14–16 (10) | 13–17 (20) | 12–15 (12) | 13–15 (7) | 13–16 (25) | 14–18 (10) |
VS | ||||||||
mean ± SD | 67.0 ± 0.00 | 67.0 ± 1.41 | 67.5. ± 2.12 | 65.7 ± 1.89 | 67.7 ± 2.42 | 66.2 ± 3.49 | 65.7 ± 2.70 | 67.0 ± 2.12 |
range (n) | 67 (2) | 66–68 (2) | 64–71 (10) | 62–70 (20) | 64–71 (12) | 64–73 (6) | 61–71 (23) | 64–70 (10) |
SPCLR | ||||||||
mean ± SD | 12.0 ± 0.00 | 12.5 ± 0.71 | 8.0 ± 0.00 | 9.2 ± 0.77 | 10.0 ± 0.00 | 8.3 ± 0.76 | 9.2 ± 0.60 | 10.0 ± 0.00 |
range (n) | 12 (2) | 12–13 (2) | 8 (10) | 8–10 (20) | 10 (10) | 8–10 (7) | 8–10 (21) | 10 (10) |
RTS | ||||||||
mean ± SD | 21.0 ± 0.00 | 22.5 ± 0.71 | 18.7 ± 0.52 | 20.3 ± 0.78 | 20.8 ± 0.40 | 18.7 ± 0.52 | 20.1 ± 1.07 | 21.4 ± 0.89 |
range (n) | 21 (2) | 22–23 (2) | 18–19 (6) | 19–21 (12) | 20–21 (11) | 18–19 (6) | 19–22 (14) | 21–23 (6) |
PoSbO | ||||||||
mean ± SD | 3.5 ± 0.71 | 5 ± 0.00 | 3.7 ± 0.48 | 4.0 ± 0.22 | 3.8 ± 0.45 | 4.0 ± 0.00 | 3.9 ± 0.28 | 4.0 ± 0.00 |
range (n) | 3–4 (2) | 5 (2) | 3–4 (10) | 3–4 (20) | 3–4 (12) | 4 (7) | 3–4 (25) | 4 (10) |
PoSL | ||||||||
mean ± SD | 2.0 ± 0.00 | 2.0 ± 0.00 | 2.0 ± 0.00 | 2.0 ± 0.00 | 2.0 ± 0.00 | 1.7 ± 0.49 | 2.0 ± 0.00 | 1.0 ± 0.00 |
range (n) | 2 (2) | 2 (2) | 2 (10) | 2 (20) | 2 (12) | 1–2 (7) | 2 (25) | 1 (10) |
Elo | ||||||||
mean ± SD | 2.0 ± 0.00 | 2.5 ± 0.71 | 1.1 ± 0.32 | 2.2 ± 0.52 | 1.9 ± 0.29 | 1.7 ± 0.76 | 1.14 ± 0.35 | 2.3 ± 0.48 |
range (n) | 2 (2) | 2–3 (2) | 1–2 (10) | 1–3 (20) | 1–2 (12) | 1–3 (7) | 1–2 (22) | 2–3 (10) |
All specimens of Indian Subdoluseps lineages and species that we sampled have a transparent window in the lower eyelid (Fig.
Ventral photos of cleared and stained specimens and one dry skull: A adult female Dravidoseps nilgiriensis comb. nov. (AKR 2586); B subadult Dravidoseps srivilliputhurensis sp. nov. (AKR 1763); C subadult Dravidoseps srivilliputhurensis sp. nov. (AKR 1717); D dry skull preparation of Subdoluseps bowringii (FMNH 196173). Photos by Akshay Khandekar (A–C) and Stephanie Ware (D).
Embryos of Dravidoseps gen. nov. at different development stages: A two pairs in D. goaensis comb. nov. in early developmental stages (neotype, BNHS 2567); B two pairs in D. gingeeensis sp. nov. in early developmental stages (holotype, NRC-AA-8273); C–E various development stages of D. kalakadensis sp. nov. (paratypes, BNHS 2829, ZSI-R-28613, and ZSI-R-28615 respectively); F–N various development stages of D. srivilliputhurensis sp. nov. (paratypes, BNHS 2832, BNHS 2834, BNHS 2835, BNHS 2837–2839, NRC-AA-8284, NRC-AA-8285, ZSI-R-28618); O two almost completely developed in D. tamilnaduensis sp. nov. (paratype, BNHS 2859). Scale bars = 5 mm; photos by Akshay Khandekar.
We recognize nine Indian lineages of Subdoluseps, supported both by the species delimitation analyses as well as fixed differences from all other lineages in at least one nuclear marker. We thus treat these nine lineages as representatives of putative species (apart from the lineage sp. Kalrayan, which does not include a voucher). Taken together, the phylogenetic, morphological, and ecological evidence all demonstrate that the Indian clade of Subdoluseps is highly divergent from the Southeast Asian clade, which includes the type species of the genus S. bowringii. We thus describe the Indian clade as a new genus and describe five new species below.
Lygosoma pruthi Sharma, 1977
Riopa –
Lygosoma – Das (1996)
Subdoluseps –
Medium-sized skinks (adult SVL < 58 mm; n = 89), original tail equal to or slightly longer than body. Dorsal scales on body and tail smooth, cycloid, imbricate; ventrals similar except marginally larger on pectoral and precloacal region; scales on lateral tail base smooth or tricarinate; 62–70 scales in paravertebral rows; 26–32 scales around mid-body; 61–73 ventral scales (rarely 76, n = 1/89); 8–12 enlarged precloacal scales (rarely 13, n = 1/89); and 18–23 scales round the tail. Supranasals in contact with each other behind rostral (rarely not in contact, n = 1/89); single frontonasal; prefrontals relatively small, widely separated on midline; frontal elongate, bell-shaped; four supraoculars; three supraoculars in contact with frontoparietal (rarely two, n = 4/89); frontoparietal divided; interparietal diamond-shaped, eyespot in posterior projection; parietals large, in medial contact posterior to interparietal; 2–4 nuchals, either in contact behind parietals or separated medially by 1–3 paravertebral scales. Nasal divided; two loreals; a single pre-supraocular; two preoculars (rarely three, n = 4/89); and a single sub-preocular (rarely absent, n = 5/89); 6–8 supraciliaries (rarely nine, n = 1/89); lower eyelid with enlarged, transparent central window; a single post-supraocular and postocular; and three or four sub-postoculars (rarely five, n = 3/89); a single primary, two secondary (rarely three, n = 1/89), and three tertiary (rarely four, n = 1/89) temporals. Six or seven supralabials and infralabials; fourth or fifth supralabial elongate, below eye; one or two post-supralabials; 1–3 ear lobules; three enlarged pairs of chin shields. Pentadactyl; limbs well-developed; subdigital lamellae unpaired, smooth to weakly keeled; 4–7 lamellae under digit I of manus and pes, 9–12 lamellae under digit IV of manus and 12–17 lamellae under digit IV of pes (rarely 18, n = 1/89). Viviparous, litter size 2–4. Dorsum light coconut to dark chocolate brown; thick dark band from rostrum to tail speckled with light spots; supralabials with a white streak; males with yellow on lower parts of forebody and flanks, sometimes extending onto belly; venter white with some darker markings (Fig.
Dravidoseps gen. nov. species in life: A D. pruthi comb. nov. (neotype, NRC-AA-1291); B D. goaensis comb. nov. (neotype, BNHS 2567); C D. nilgiriensis comb. nov. (ZSI-R-28604); D D. gingeeensis sp. nov. (holotype, NRC-AA-8273); E D. jawadhuensis sp. nov. (holotype, NRC-AA-8274); F D. kalakadensis sp. nov. (holotype, NRC-AA-8275); G D. srivilliputhurensis sp. nov. (holotype, NRC-AA-8279); and H D. tamilnaduensis sp. nov. (holotype, NRC-AA-8286). Photos by Akshay Khandekar (B–D, F–H) and Ishan Agarwal (A, E).
Dravidoseps gen. nov. differs from Subdoluseps by the presence of a transparent central window in the lower eyelid (versus no transparent central window in the lower eyelid), by the presence of an open secondary palate (versus a closed secondary palate) and by being viviparous (versus oviparous) (
Dravidoseps goaensis comb. nov., Dravidoseps pruthi comb. nov., Dravidoseps nilgiriensis comb. nov., and five species described below.
This genus comprises species that share a more recent common ancestor with Dravidoseps pruthi comb. nov. than with Subdoluseps bowringii.
A combination of the Sanskrit ‘Dravida’, referring to the original inhabitants of southern India and Sri Lanka, and the Ancient Greek ‘seps’, for a snake-like creature that has been previously used in skink generic names (e.g.
The three known species and five unnamed lineages (described below) are distributed in peninsular India, including the northern Western Ghats, central and southern Western Ghats, the edge of the Mysore Plateau and isolated massifs in Tamil Nadu (Fig.
Riopa pruthi –
Lygosoma pruthi – Das (1996, 2003)
Subdoluseps pruthi –
ZSI 22393, unsexed adult, “Chitteri range, lat. 11°50′N, long. 78°25′E, Salem District, Tamil Nadu, India [= Sitteri, Dharmapuri District, Tamil Nadu, India; ~11.833°N, 78.417°E] ”, collected by Dr. H. S. Pruthi in 1929 (
Two unsexed specimens in ZSI (museum numbers unavailable), same data and status as holotype.
(designated herein) NRC-AA-1291 (AK-R 2222). Adult female, from Sitteri Hills (11.90208°N, 78.51800°E; elevation ca. 880 m asl.), Dharmapuri District, Tamil Nadu State, India, collected by Akshay Khandekar, Ishan Agarwal, Swapnil Pawar and team on 29th May 2022.
NRC-AA-1292 (AK 803), NRC-AA-1293 (AK 804), and NRC-AA-1294 (AK 805), subadults, from Forest Department campus, Sitteri Hills (11.89152°N, 78.50747°E; elevation ca. 950 m asl.), Dharmapuri District, collected by Akshay Khandekar, Ishan Agarwal, Swapnil Pawar, Tejas Thackeray and team on 1st June 2019; BNHS 2525 (AK-R 2197), BNHS 2557 (AK-R 2198), BNHS 2558 (AK-R 2200), adult males, from Palamalai Hills (11.70744°N, 77.73598°E; elevation ca. 1000 m asl.); ZSI-R-28600 (AK-R 2201), subadult, from Palamalai Hills (11.73335°N, 77.73156°E; elevation ca. 600 m asl.), Salem District, same collectors as neotype, collected on 28th May 2022; ZSI-R-28601 (AK-R 2716), adult male, from Vanavasi Reserve Forest (11.75203°N, 77.84129°E; elevation ca. 520 m asl.), Salem District, same collectors as neotype, collected on 11th October 2022; ZSI-R-28602 (AK-R 2750), adult female, from north of Yercaud (11.90822°N, 78.18878°E; elevation ca. 650 m asl.), in Shevaroy Hills, Salem District, same collectors as neotype, collected on 15th October 2022.
AK-R-2213, from Sitteri Hills (11.92978°N, 78.51765°E), Dharmapuri District, Tamil Nadu.
Named for the collector of the holotype, H.S. Pruthi.
Pruthi’s leaf-litter skink.
A medium-sized skink, snout to vent length up to 56 mm (n = 10). Seven supralabials and six (rarely seven, n = 1/10) infralabials up to angle of mouth; fifth supralabial elongate and below eye; a single post-supralabial; 6–8 supraciliaries; a single slightly elongated nuchal on either side, separated by two or three scales behind parietal; 64–69 scales in paravertebral rows; 30 scales around mid-body; 64–70 ventral scales (rarely 76, n = 1/10); 10 enlarged precloacal scales; scales on lateral sides of tail base smooth, 21–23 scales around the tail. Subdigital lamellae unpaired, smooth to weakly keeled; five or six lamellae under digit I of manus and 4–7 under digit I of pes; 10 or 11 lamellae under digit IV of manus; and 14–17 under digit IV of pes (rarely 18, n = 1/10). Dorsum dull sand; thick grey stripe from rostrum to tail speckled with light spots; supralabials with a white streak; males with yellow on lower parts of forebody and flanks; venter glossy grey-white with some darker markings.
Dravidoseps pruthi comb. nov. is diagnosed against D. goaensis comb. nov., D. nilgiriensis comb. nov. and the new species described below as part of their respective descriptions.
Adult female (SVL 54.9 mm) in good state of preservation except body slightly bent towards right at forearm insertion, tail towards left posterior to base, a 3.4 mm long incision in the sternal region for liver tissue collection, and 15.5 mm long incision (made after taking morphological data and photos) at ventral mid-body to check for eggs/ embryos (Fig.
Dravidoseps pruthi comb. nov. (neotype, NRC-AA-1291): A dorsal view of body, B ventral view of body, C dorsal view of head, D ventral view of head, E lateral left side view of head, F ventral view of left manus, and G ventral view of left pes. Scale bars: A, B = 10 mm; C–E, G = 5 mm; F = 3 mm. Photos by Akshay Khandekar.
Body relatively slender (BW/AGL 0.23), elongate (AGL/SVL = 0.59); dorsal scales on body smooth, cycloid, imbricate; ventrals similar to dorsals except subequal from chest to vent, marginally larger on pectoral and precloacal region; 69 scales in paravertebral rows; 30 scales around mid-body; 69 ventral scales; 10 enlarged precloacal scales (Fig.
Tail original, entire, cylindrical, slightly shorter than snout-vent length (TL/SVL 0.88); dorsal and ventral scales on tail cycloid, imbricate, similar to those on body dorsum except for posterior 1/3rd on which median dorsal and subcaudal scale rows distinctly larger than surrounding scales; tail ending in a pointed scute; scales on lateral sides of tail base smooth, 21 scales around the tail (Fig.
Dorsal ground colouration of body, head and tail dull sand with a bronze tint; head with a few dark markings; dorsal scales of body and tail outlined by dark brown, centre of scales with dark markings, more prominent on hindbody and tail; limbs darker than body dorsum and with light spots; a thick grey stripe running from rostrum through orbit and onto flank and tail with scattered white spots, flanked dorsally by an indistinct, narrow, lighter stripe; supralabials with a white streak, dark band forming reticulations on lateral aspect of tail; ventral regions glossy grey-white with fine black stripes on edges of throat, neck and tail.
Mensural and meristic data for topotypic and additional specimens are given in Table
Mensural (mm) and meristic data for Dravidoseps pruthi comb. nov.. Abbreviations are listed in Materials and Methods except for: L&R = Left & Right; M = male; F = female; Sa = Subadult; * = data incomplete; and / = data unavailable.
Museum number | NRC-AA-1291 | NRC-AA-1292 | NRC-AA-1293 | NRC-AA-1294 | BNHS 2525 | BNHS 2557 | BNHS 2558 | ZSI-R-28600 | ZSI-R-28601 | ZSI-R-28602 |
Type | Neotype | Topotypes | Referred Material | |||||||
Sex | F | Sa | Sa | Sa | M | M | M | Sa | M | F |
SVL | 54.9 | 28.2 | 28.3 | 28.8 | 52.4 | 48.2 | 51.1 | 27.1 | 47.5 | 56.0 |
TL | 48.8 | 7.3* | 7.1* | 31.9 | 42.7 | 42.7 | 41.5 | 21.7* | 44.5 | 42.2 |
TW | 4.6 | 2.3 | 2.2 | 2.3 | 4.9 | 4.1 | 4.4 | 2.2 | 4.2 | 5.0 |
FL | 3.4 | 2.0 | 1.9 | 2.0 | 3.6 | 3.6 | 3.0 | 2.0* | 3.3 | 3.0 |
CL | 4.6 | 2.5 | 2.5 | 2.5 | 4.8 | 4.8 | 4.6 | 2.3* | 4.3 | 4.3 |
AGL | 32.7 | 14.8 | 15.0 | 15.2 | 30 | 27.7 | 28.4 | 13.6 | 27.7 | 34.4 |
BH | 4.0 | 2.7 | 2.9 | 2.4 | 5.0 | 5.2 | 5.7 | 2.7 | 4.3 | 4.5 |
BW | 7.7 | 4.0 | 4.1 | 4.4 | 8.2 | 7.6 | 8.1 | 4.2 | 7.7 | 8.7 |
HL | 8.2 | 5.8 | 5.5 | 5.8 | 9.3 | 8.7 | 9.6 | 5.6 | 8.0 | 8.2 |
HW | 5.9 | 3.7 | 4.0 | 3.9 | 6.3 | 6.2 | 6.1 | 3.5 | 5.4 | 5.8 |
HH | 4.3 | 2.8 | 2.6 | 2.5 | 5.1 | 4.0 | 4.6 | 2.5 | 4.2 | 4.5 |
ED | 1.7 | 1.3 | 1.3 | 1.4 | 1.9 | 1.8 | 1.8 | 1.3 | 1.7 | 1.8 |
TWD | 0.8 | 0.8 | 0.7 | 0.7 | 1.0 | 0.9 | 0.8 | 0.7 | 0.9 | 0.9 |
EE | 3.4 | 2.2 | 2.4 | 2.3 | 3.3 | 3.1 | 3.4 | 2.1 | 3.2 | 3.1 |
EL | 0.6 | 0.4 | 0.4 | 0.3 | 0.5 | 0.5 | 0.8 | 0.5 | 0.5 | 0.5 |
ES | 3.8 | 2.3 | 2.3 | 2.2 | 3.7 | 3.4 | 3.6 | 2.3 | 3.3 | 3.2 |
EN | 2.2 | 1.6 | 1.4 | 1.2 | 2.6 | 2.3 | 2.5 | 1.5 | 2.0 | 2.1 |
IN | 1.5 | 1.1 | 1.1 | 1.1 | 1.7 | 1.4 | 1.6 | 1.0 | 1.4 | 1.5 |
IO | 3.0 | 2.2 | 2.3 | 2.4 | 3.3 | 3.0 | 3.1 | 2.2 | 3.0 | 3.2 |
Nu | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 |
Sb Nu | 3 | 2 | 2 | 2 | 3 | 2 | 2 | 2 | 3 | 3 |
SL L&R | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 |
IL L&R | 6&6 | 6&6 | 6&6 | 6&6 | 6&6 | 6&6 | 6&6 | 6&6 | 6&7 | 6&6 |
PoSL L&R | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 |
Elo L&R | 2&2 | 3&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&3 | 3&3 | 3&2 | 2&2 |
PVS | 69 | 69 | 69 | 67 | 64 | 64 | 65 | 66 | 68 | 66 |
RBS | 30 | 30 | 30 | 30 | 30 | 30 | 30 | 30 | 30 | 30 |
VS | 69 | 69 | 76 | 68 | 66 | 65 | 64 | 65 | 67 | 70 |
SPCLR | 10 | 10 | 10 | 10 | 10 | 10 | 10 | 10 | 10 | 10 |
RTS | 21 | / | / | / | 21 | 21 | 21 | / | 23 | / |
LamF1 L&R | 6&6 | 6&6 | 5&5 | 5&6 | 6&6 | 5&5 | 6&6 | 6&6 | 6&6 | 5&6 |
LamF4 L&R | 11&11 | 11&10 | 10&10 | 11&11 | 11&11 | 11&12 | 11&11 | 11&11 | 11&11 | 11&11 |
LamT1 L&R | 6&6 | 5&5 | 5&6 | 5&5 | 7&6 | 6&6 | 3*&6 | 4&4 | 6&6 | 6&6 |
LamT4 L&R | 16&15 | 14&16 | 15&16 | 16&16 | 17&14* | 17&16 | 17&12* | 16&16 | 18&16* | 10*&15 |
Elongate supralabial below eye, fourth (1) or fifth (0) L&R | 0&0 | 0&0 | 0&0 | 0&0 | 0&0 | 0&0 | 0&0 | 0&0 | 0&0 | 0&0 |
Dravidoseps pruthi comb. nov. is known from Sitteri Hills in Dharmapuri District (type locality), and the northern slopes of Yercaud in Shevaroy Hills, Vanavasi Reserve Forest, and Palamalai, all in Salem District, Tamil Nadu India. The two most distant localities (Palamalai and Sitteri Hills) are >85 km apart in aerial distance (Fig.
Diurnal, found in the day either moving in leaf litter, in soil or under rocks. The four localities we recorded the species from are at elevations of 500–1000 m asl. with a mix of scrub, deciduous and dry evergreen to semi-evergreen forest with scattered sheet rocks (Fig.
General habitats of all species of Dravidoseps sp. nov.: A type locality of D. pruthi comb. nov.; B neotype locality of D. goaensis comb. nov.; C habitat photo of D. nilgiriensis comb. nov., from Thamarakarai; D type locality of D. gingeeensis sp. nov.; E type locality of D. jawadhuensis sp. nov.; F type locality of D. kalakadensis sp. nov.; G paratype locality of D. srivilliputhurensis sp. nov., near Atthi Kovil Falls; and H type locality of D. tamilnaduensis sp. nov.. Photos by Akshay Khandekar (A–C, F–H), Ishan Agarwal (D), and Vinod (E).
Unknown. No gravid female in the additional material examined (two non-gravid females dissected: ZSI-R-28602 and neotype, NRC-AA-1291).
Our topotypical and genetically assigned specimens match the original description provided by
Riopa goaensis –
Lygosoma goaensis – Das (1996)
ZSI 22032, unsexed adult, “ca. 5 km N.E. of Forest Rest House, Molem” [South Goa District, Goa State, India], collected by Zoological Survey of India during 1966–1969 (
(designated herein) BNHS 2567 (AK 1345), adult female, from the vicinity of Hotel Whistling Woods (15.96006°N, 73.99736°E; elevation ca. 720 m asl.), Amboli, Sindhudurg District, Maharashtra State, India, collected by Akshay Khandekar on 18th February 2021.
ZSI-R-28612 (AK-R 847), adult male same data as neotype except collected on 3rd January 2022; NRC-AA-1303 (AK 1052), subadult, from near Ugwai temple (16.37237°N, 73.86344°E; elevation ca. 650 m asl.), Dajipur; NRC-AA-1304 (AK 1192), subadult, from Talaye (16.65794°N, 73.91782°E; elevation ca. 600 m asl.); NRC-AA-1305 (AK 1300), adult male, from near Pandivare (16.36671°N, 74.09036°E; elevation ca. 820 m asl.); and BNHS 2566 (AK 1303), adult female, from near Kapurkada Falls, Washi (16.72807°N, 73.87645°E; elevation ca. 700 m asl.); all in Kolhapur District, Maharashtra State, India, same collectors as neotype, collected March–July 2019. NRC-AA-1302 (AK-R 2808), subadult, from Ustam (15.55983°N, 74.18788°E; elevation ca. 150 m asl.), South Goa District, Goa State, India, collected by Akshay Khandekar, Satpal Gangalmale, and Swapnil Pawar on 20 June 2023.
Named for its type locality, Goa.
Goan leaf-litter skink.
A medium-sized skink snout to vent length up to 56 mm (n = 7). Six or seven supralabials and six (rarely seven, n = 1/7) infralabials up to angle of mouth; fifth supralabial elongate and below eye (rarely fifth on one side, n = 2/7); one or two post-supralabials; seven supraciliaries (rarely six on one side, n = 1/7); a single slightly elongated nuchal on either side (rarely two on one side n = 1/7), in contact with each other behind parietal or separated by one or two scales; 62–67 scales in paravertebral rows; 28–30 scales around mid-body; 64–66 ventral scales (rarely 73, n = 1/7); eight enlarged precloacal scales (rarely 10, n = 1/7); scales on lateral sides of tail base smooth, 18 or 19 scales around the tail. Subdigital lamellae unpaired, smooth; five or six lamellae under digit I of manus and pes (rarely four on one side on manus, n = 1/7); 10 or 11 lamellae under digit IV of manus; and 13–15 under digit IV of pes (rarely 12 on one side, n = 1/7). Dorsum coconut brown; thick stripe from rostrum to tail speckled with light spots; supralabials with white streak; males with yellow on lower parts of forebody and flanks; venter glossy grey-white with darker markings.
Dravidoseps goaensis comb. nov. can be diagnosed from D. pruthi comb. nov. (data in parentheses) based on the following characters: keeled scales on tail base (versus unkeeled scales on tail base); 29.0 ± 1.00 (28–30) RBS (versus 30.0 ± 0.00 (30)); 13.4 ± 0.79 (13–15) Lam4T (versus 16.1 ± 1.20 (14–18)); 18 or 19 RTS (versus 21–23 in D. pruthi comb. nov.). Dravidoseps goaensis comb. nov. is diagnosed against D. nilgiriensis comb. nov. and the new species described below as part of their respective descriptions.
Adult female (SVL 54.9 mm) in good state of preservation except tail damaged at three places along its length, a 4.0 mm long incision in the sternal region for liver tissue collection, and 14.1 mm long incision at ventral mid-body (made after taking morphological data and photos) to check for eggs/ embryos (Fig.
Dravidoseps goaensis comb. nov. (neotype, BNHS 2567): A dorsal view of body, B ventral view of body, C dorsal view of head, D ventral view of head, E lateral right side view of head, F ventral view of right manus, and G ventral view of right pes. Scale bars: A, B = 10 mm; C–E, G = 5 mm; F = 3 mm; photos by Akshay Khandekar.
Body relatively slender (BW/AGL 0.14), elongate (AGL/SVL = 0.62); dorsal scales on body smooth, cycloid, imbricate; ventrals similar to dorsals except subequal from chest to vent, marginally larger on pectoral and precloacal region; 64 scales in paravertebral rows; 30 scales around mid-body; 66 ventral scales; eight enlarged precloacal scales (Fig.
Tail original, entire, cylindrical, marginally shorter than snout-vent length (TL/SVL 0.94); damaged at three places at its length; dorsal and ventral scales on tail cycloid, imbricate, similar to those on body dorsum except for posterior 1/3rd on which median dorsal and subcaudal scale rows distinctly larger than surrounding scales; tail ending in a pointed scute; scales on lateral sides of tail base keeled, tricarinate; 19 scales around the tail (Fig.
Dorsal ground colouration of body, head and tail coconut brown with a bronze tint; head with scattered dark markings; dorsal scales of body and tail finely outlined by dark brown, centre of scales with dark markings forming indistinct stripes; limbs darker than body dorsum and with light spots; a thick stripe with a fine black dorsolateral border running from rostrum through orbit and onto flank and tail with scattered light spots, some scales with orange; supralabials with a white streak; ventral regions glossy, off-white with scattered black markings.
Mensural and meristic data for the topotypic and additional specimens are given in Table
Mensural (mm) and meristic data for Dravidoseps goaensis comb. nov.. Abbreviations are listed in Materials and Methods except for: L&R = Left & Right; M = male; F = female; Sa = Subadult; * = tail incomplete; and / = data unavailable.
Museum number | BNHS 2567 | NRC-AA-1302 | NRC-AA-1303 | NRC-AA-1304 | NRC-AA-1305 | BNHS 2566 | ZSI-R-28612 |
Neotype | Topotype | Referred Material | |||||
Sex | F | Sa | Sa | Sa | M | F | M |
SVL | 55.2 | 41.1 | 35.2 | 38.2 | 48.3 | 42.3 | 43.7 |
TL | 51.9 | 44.8 | 39.1 | 22.6 | 5.9* | 28.1* | 15.5* |
TW | 5.1 | 3.2 | 2.9 | 3.4 | 4.4 | 3.9 | 4.3 |
FL | 3.2 | 2.8 | 2.7 | 2.7 | 3.0 | 2.8 | 3.0 |
CL | 4.1 | 3.8 | 3.1 | 3.2 | 3.9 | 3.6 | 4.0 |
AGL | 34.3 | 24.2 | 18.3 | 21.1 | 28.6 | 23.4 | 25.2 |
BH | 5.1 | 4.1 | 2.3 | 2.9 | 4.0 | 4.3 | 5.3 |
BW | 8.2 | 6.1 | 5.6 | 6.1 | 6.9 | 7.0 | 7.5 |
HL | 8.8 | 7.1 | 7.0 | 7.0 | 8.6 | 8.4 | 8.7 |
HW | 6.5 | 5.1 | 4.8 | 5.5 | 5.9 | 5.6 | 5.8 |
HH | 4.5 | 3.2 | 3.1 | 3.2 | 4.2 | 3.6 | 4.6 |
ED | 1.8 | 1.5 | 1.4 | 1.4 | 1.8 | 1.6 | 1.7 |
TWD | 0.8 | 0.7 | 0.7 | 0.7 | 0.8 | 0.8 | 0.7 |
EE | 3.5 | 2.8 | 2.8 | 3.1 | 3.4 | 3.1 | 3.8 |
EL | 0.7 | 0.8 | 0.5 | 0.5 | 0.7 | 0.6 | 0.6 |
ES | 3.6 | 2.9 | 2.7 | 2.9 | 3.4 | 3.3 | 3.7 |
EN | 2.4 | 1.9 | 1.8 | 1.8 | 2.2 | 2.2 | 2.4 |
IN | 1.5 | 1.2 | 1.3 | 1.2 | 1.4 | 1.5 | 1.5 |
IO | 3.5 | 2.6 | 2.6 | 2.8 | 3.2 | 3.1 | 3.1 |
Nu | 2&1 | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 |
Sb Nu | 1 | 0 | 0 | 1 | 0 | 1 | 2 |
SL L&R | 7&7 | 7&6 | 6&7 | 7&7 | 7&7 | 7&7 | 6&7 |
IL L&R | 6&6 | 6&6 | 6&6 | 6&6 | 6&7 | 6&6 | 6&6 |
PoSL L&R | 1&1 | 2&2 | 2&2 | 2&2 | 1&1 | 2&2 | 2&1 |
Elo L&R | 1&1 | 3&3 | 2&2 | 2&2 | 1&1 | 2&2 | 1&1 |
PVS | 64 | 66 | 62 | 65 | 67 | 63 | 62 |
RBS | 30 | 29 | 28 | 28 | 30 | 28 | 30 |
VS | 66 | 73 | 64 | 66 | / | 64 | 64 |
SPCLR | 8 | 10 | 8 | 8 | 8 | 8 | 8 |
RTS | 19 | 19 | 18 | 19 | / | 18 | 19 |
LamF1 L&R | 5&5 | 6&6 | 6&6 | 6&6 | 4&5 | 5&5 | 5&5 |
LamF4 L&R | 10&10 | 11&11 | 11&11 | 10&10 | 10&11 | 10&10 | 11&11 |
LamT1 L&R | 6&5 | 5&6 | 6&6 | 6&6 | 5&5 | 6&6 | 6&6 |
LamT4 L&R | 13&13 | 13&12 | 15&15 | 14&13 | 13&13 | 13&14 | 13&13 |
Elongate supralabial below eye, fourth (1) or fifth (0) L&R | 0&0 | 0&1 | 1&0 | 0&0 | 0&0 | 0&0 | 0&0 |
Apart from the type locality (“ca. 5 kms NE of Forest Rest House, Molem [Goa]; Sharma, 1976), Dravidoseps goaensis comb. nov. has been recorded by us from Ustam and Mhadei Wildlife Sanctuary, South Goa District in Goa State (< 25 km south of the type locality) and from Amboli in Sindhudurg District, four localities (Dajipur, Talaye, Padivare, and Washi) Kolhapur District of Maharashtra State, India; all from the northern Western Ghats. The farthest two reported localities (Washi in north and Mhadei Wildlife Sanctuary in south) are ~140 km apart from each other in aerial distance.
The four localities we recorded the species from are at elevations of 150–820 m and habitats vary from moist deciduous to semi evergreen and evergreen forest (Fig.
Viviparous, four embryos in early stages of development in holotype, ZSI 22032 (Fig.
Article 75.3.6 of The Code (Anonymous 1999) states that a neotype should be “nearly as practicable from the original type locality”, however we chose a non-topotypic, adult female as the neotype as the single specimen from closest to the type locality is a subadult, and these were shown to belong to the same lineage genetically. Our neotype and other specimens match the original description provided by
Subdoluseps nilgiriensis –
BNHS 2642, unsexed adult, Anaikatti hills (11.110°N, 76.769°E; 600 m asl.) Coimbatore District, Tamil Nadu State, India, collected by Avrajjal Ghosh, SR Ganesh and NS Achyuthan on September 2019.
BNHS 2643 and BNHS 2644, unsexed adults, same collection information as the holotype.
NRC-AA-1295 (AK R 1854), adult male from near Mangalamkombu (10.31831°N, 77.65654°E; elevation ca. 1400 m asl.) and NRC-AA-1296 (AK-R 1877), adult male from near Mangalamkombu (10.303667°N, 77.640251°E; elevation ca. 1400 m asl.), Palani Hills, Dindigul District, Tamil Nadu, India, collected by Akshay Khandekar, Ishan Agarwal, Swapnil Pawar and team on 13th May 2022; NRC-AA-1297 (AK-R 2022), NRC-AA-1298 (AK-R 2023), subadults, from Aliyar Reserve Forest (10.48438°N, 76.92303°E; elevation ca. 400 m asl.), Anaimalai Tiger Reserve, Coimbatore District, same collectors as above except collected on 20th May 2022; NRC-AA-1299 (AK-R 2080), adult female, NRC-AA-1300 (AK-R 2081), subadult, from near Kattanchi view point (11.19985°N, 76.90867°E; elevation ca. 520 m asl.), close to Mettupalayam, Coimbatore District, same collectors as above except collected on 23th May 2022; NRC-AA-1301 (AK-R 2172), subadult, from Thamarakarai Forest Guesthouse campus (11.76779°N, 77.55715°E; elevation ca. 1000 m asl.), Erode District, same collectors as above except collected on 26th May 2022; BNHS 2559 (AK-R 2539), BNHS 2561 (AK-R 2541), adult females, BNHS 2560 (AK-R 2540), adult male, from near Kutladampatti Falls (10.12995°N, 78.01784°E; elevation ca. 280 m asl.), and BNHS 2562 (AK-R 2542), BNHS 2563 (AK-R 2543), subadults, from near Viralipatti (10.11638°N, 77.98282°E; elevation ca. 240 m asl.), Sirumalai Hills, Madurai District, same collectors as above except collected on 29th September 2022; BNHS 2564 (AK-R 2585), BNHS 2565 (AK-R 2586), ZSI-R-28603 (AK-R 2587), adult females, from Karanthamalai Hills (10.33737°N, 78.15939°E; elevation ca. 420 m asl.), Dindigul District, same collectors as above except collected on 3rd October 2022; ZSI-R-28604 (AK-R 2667), ZSI-R-28605 (AK-R 2668), adult males, ZSI-R-28606 (AK-R 2669), subadult, from Perunguntru trekking route (10.43080°N, 76.88132°E; elevation ca. 900 m asl.), and ZSI-R-28607 (AK-R 2671), ZSI-R-28608 (AK-R 2672), ZSI-R-28609 (AK-R 2673) subadults, from near Varagaliyar elephant camp (10.41913°N, 76.86747°E; elevation ca. 620 m asl.), Anaimalai Tiger Reserve, Coimbatore District, same collectors as above except collected on 9rd October 2022; ZSI-R-28694 (AK-R 2726), subadult, from Selur Reserve Forest, Kolli Hills (11.19463°N, 78.37537°E; elevation ca. 390 m asl.), Namakkal District, same collection data as above except on 12th October 2022.
AK-R-2173, same collection data as NRC-AA-1301 (AK-R 2172).
Named for its type locality, the Nilgiri Hills.
Nilgiri leaf-litter skink.
A medium-sized skink snout to vent length up to 58 mm (n = 22). Seven supralabials and six (rarely seven, n = 4/22) infralabials up to angle of mouth; fifth supralabial elongate and below eye; two post-supralabials; seven or eight supraciliaries (rarely nine on one side, n = 1/19); a single slightly elongated nuchal on either side (rarely two on one side, n = 1/22), in contact with each other behind parietal (rarely separated by a single scale, n = 5/22); 62–70 scales in paravertebral rows; 26–30 scales around mid-body; 61–71 ventral scales; 8–10 enlarged precloacal scales; scales on lateral sides of tail base smooth, 19–21 scales around the tail. Subdigital lamellae unpaired, smooth on manus and smooth to weakly keeled on pes; five or six lamellae under digit I of manus (rarely four and seven, n = 1/22), and 5–7 under digit I of pes; 9–11 lamellae under digit IV of manus (rarely 12, n = 1/22); and 13–15 under digit IV of pes (rarely 16, n = 1/22). Dorsum brown with black markings; thick black stripe from rostrum to tail speckled with light spots, males with yellow on lower parts of forebody and flanks extending onto belly; supralabials with white streak; venter glossy grey-white with some darker markings.
Dravidoseps nilgiriensis comb. nov. can be diagnosed from known congeners based on the following characters: 28.1 ± 0.86 (26–30) RBS (versus 30.0 ± 0.00 (30) in D. pruthi comb. nov., and 29.0 ± 1.00 (28–30 in D. goaensis comb. nov.); an average of 14.4 ± 0.76 (13–16) (versus 16.1 ± 1.20 (14–18) Lam4T in D. pruthi comb. nov., and 13.4 ± 0.79 (13–15) in D. goaensis comb. nov.); two PoSL on each side (versus a single PoSL on each side in D. pruthi comb. nov.); a single NU on either side and Sb NU either absent or rarely only a single present (versus a single Nu on either side and two or three Sb Nu present in D. pruthi comb. nov.); unkeeled scales on tail base (versus keeled scales on tail base in D. goaensis comb. nov.). Dravidoseps nilgiriensis comb. nov. is diagnosed against the new species described below as part of their respective descriptions.
Dravidoseps nilgiriensis comb. nov. is the most widely distributed member of the genus, known from the Western Ghats (north and south of Palghat gap) and hills outside the Western Ghats, between an elevation range of 200–1400 m asl.; in Tamil Nadu State, India (Fig.
At Palani Hills, individuals were collected/ observed sheltering under rocks in the afternoon (1230–1330 hrs) in a small open patch surrounded by wet evergreen forest at high elevation (1400 m asl.). Sympatric lizards recorded were Cnemaspis cf. palanica, Cyrtodactylus (Geckoella) cf. collegalensis, Dravidogecko sp., Eutropis cf. carinata, Kaestlea sp. Riopa albopunctata, Ristella sp., and Monilesaurus cf. rouxii. At Anaimalai Tiger Reserve, the species was observed in a relatively open area surrounded by evergreen forest located along the Perunguntru trekking route, near Varagaliyar Elephant Camp, and also in moist deciduous to semievergreen forest at Aliyar Reserve Forest. Specimens were observed either buried in loose soil under rocks or moving in the leaf-litter during morning hours (0930–1200 hrs). Sympatric lizards recorded were Cnemaspis cf. monticola, Cn. cf. littoralis, Eutropis carinata, E. macularia, Ristella sp., Sphenomorphus dussumieri (Duméril & Bibron), Calotes calotes (Linnaeus), and Monilesaurus cf. rouxii. Near Mettupalayam, individuals were found under rocks in the morning (0930 hr) in thorny dry deciduous forests dominated by granite sheet rocks. Other sympatric skinks were Eutropis bibronii (Gray), and Riopa albopunctata. At Thamarakarai, a single juvenile was collected from under a rock in the forest guest house campus surrounded by deciduous forests (Fig.
Unknown. No gravid female in the additional material examined (non-gravid females dissected: NRC-AA-1299, BNHS 2559, BNHS 2561, BNHS 2564, BNHS 2565 ranging in SVL from 42.7–52.6 mm).
We examined the type series (holotype and two paratypes) of this species housed at BNHS and found discrepancies in some mensural (SVL, TL, AGL, CL, HL, EE) and meristic (PVS, RBS, VS) characters provided in the original description by
Mensural (mm) and meristic data for Dravidoseps nilgiriensis comb. nov.. Abbreviations are listed in Materials and Methods except for: L&R = Left & Right; M = male; F= female; Sa = Subadult; * = data incomplete; / = data unavailable, # indicates discrepancy with original description (
Museum number | BNHS 2642 | BNHS 2643 | BNHS 2644 | NRC-AA-1295 | NRC-AA-1296 | NRC-AA-1297 | NRC-AA-1298 | NRC-AA-1299 | NRC-AA-1300 | NRC-AA-1301 | BNHS 2559 | BNHS 2560 | BNHS 2561 |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Type | Holotype | Paratypes | Referred Material | ||||||||||
Sex | F? | F? | F? | M | M | Sa | Sa | F | Sa | Sa | F | M | F? |
SVL | 57.1# | 43.4# | 43.7# | 45.7 | 50.2 | 28.1 | 32.2 | 46.0 | 28.4 | 24.9 | 52.6 | 50.2 | 42.7 |
TL | 48.2# | 49.8# | 38.3*# | 41.3 | 43.9 | 7.2* | 16.9* | 44.9 | 7.6* | 4.7* | 43.2 | 34.7 | 31.2* |
TW | 3.9 | 3.5 | 3.6 | 4.7 | 5.2 | 2.2 | 2.4 | 3.6 | 2.2 | 2.0 | 4.7 | 5.1 | 3.6 |
FL | 2.1* | 2.6 | 2.8 | 3.1 | 2.9 | 2.0* | 1.9* | 2.5 | 1.8* | 1.8 | 2.9 | 3.1 | 2.4 |
CL | 4.1# | 3.6 | 3.9 | 4.0 | 4.1 | 2.1* | 2.5 | 3.5 | 2.0* | 2.1 | 3.9 | 4.1 | 3.7 |
AGL | 36.4# | 25.5 | 25.9 | 25.8 | 28.5 | 16.2 | 18.8 | 29.6 | 15.4 | 14.2 | 31.7 | 30.4 | 25.8 |
BH | 4.9 | 3.1 | 4.1 | 4.9 | 4.5 | 2.3 | 3.3 | 4.3 | 3.1 | 2.3 | 5.0 | 5.1 | 4.6 |
BW | 6.2 | 5.3 | 5.8 | 7.3 | 7.7 | 4.2 | 5.0 | 6.7 | 3.8 | 4.0 | 8.4 | 7.4 | 6.7 |
HL | 8.2 | 7.7# | 8.0# | 8.4 | 8.8 | 5.4 | 6.1 | 7.7 | 5.6 | 4.9 | 8.4 | 8.1 | 7.1 |
HW | 5.8 | 4.7 | 5.0 | 6.2 | 6.0 | 3.4 | 3.9 | 4.5 | 2.4 | 3.0 | 5.6 | 6.0 | 4.9 |
HH | 4.1 | 3.0 | 3.4 | 4.4 | 4.2 | 2.6 | 2.6 | 3.7 | 2.5 | 2.2 | 3.7 | 9.2 | 3.8 |
ED | 1.7 | 1.4 | 1.7 | 1.7 | 1.8 | 1.2 | 1.4 | 1.6 | 1.3 | 1.2 | 1.5 | 1.7 | 1.4 |
TWD | / | / | / | 0.6 | 0.7 | 0.6 | 0.6 | 0.7 | 0.5 | 0.5 | 0.8 | 0.8 | 0.7 |
EE | 3.7# | 3.1# | 3.3# | 3.3 | 3.6 | 2.2 | 2.5 | 3.0 | 2.2 | 2.1 | 3.1 | 3.2 | 2.9 |
EL | 0.6 | 0.6 | 0.6 | 0.6 | 0.6 | 0.3 | 0.5 | 0.4 | 0.3 | 0.5 | 0.5 | 0.5 | 0.6 |
ES | 3.4 | 3.0 | 3.3 | 3.3 | 3.6 | 2.1 | 2.5 | 3.0 | 2.2 | 2.1 | 3.2 | 3.5 | 2.8 |
EN | 2.1 | 1.8 | 1.9 | 2.3 | 2.4 | 1.4 | 1.6 | 1.9 | 1.4 | 1.4 | 2.1 | 2.4 | 1.6 |
IN | 1.3 | 1.3 | 1.3 | 1.4 | 1.6 | 0.9 | 1.0 | 1.4 | 1.1 | 0.8 | 1.5 | 1.5 | 1.3 |
IO | 3.1 | 2.4 | 2.7 | 2.9 | 3.1 | 2.0 | 2.2 | 2.7 | 2.0 | 2.0 | 2.9 | 3.2 | 2.7 |
Nu | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 |
Sb Nu | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 |
SL L&R | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 |
IL L&R | 6&6 | 7&6 | 7&7 | 7&6 | 6&7 | 6&6 | 6&6 | 6&6 | 6&6 | 6&6 | 6&6 | 6&6 | 6&6 |
PoSL L&R | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 |
Elo L&R | / | / | / | 1&1 | 2&1 | 1&1 | 1&1 | 1&/ | 1&1 | 2&1 | 1&1 | 1&1 | 1&1 |
PVS | 68 | 70# | 67 | 63 | 63 | 67 | 66 | 67 | 67 | 67 | 66 | 64 | 63 |
RBS | 28# | 28 | 28 | 28 | 26 | 28 | 28 | 30 | 29 | 28 | 30 | 28 | 28 |
VS | 66# | 71 | 67# | 64 | 63 | 68 | 67 | 65 | 63* | 63 | 68 | 64 | 61 |
SPCLR | / | / | / | 9 | 10 | / | 8 | 9 | 9 | 9 | 10 | 9 | 9 |
RTS | / | / | / | 20 | 19 | / | / | / | / | / | 21 | 22 | 21 |
LamF1 L&R | 5&5 | 4&5 | 6&6 | 6&7 | *&6 | 5&5 | 5&5 | 6&6 | 5&5 | 5&5 | 6&6 | 6&6 | 5&5 |
LamF4 L&R | 9&9 | 11&1 | 11&11 | 11&11 | *&10 | 11&10 | 12&11 | 10&9 | 11&10 | 9&11 | 10&11 | 11&11 | 10&10 |
LamT1 L&R | 5&5 | 5&5 | 7&6 | 6&6 | 6&6 | 6&6 | 6&5 | 6&5 | 6&6 | 5&5 | 5&5 | 6&6 | 5&5 |
LamT4 L&R | 14&14 | 15&15 | 14&15 | 16&15 | 14&13 | 13&14 | 15&14 | 15&15 | 15&15 | 14&13 | 14&14 | 15&15 | 13&14 |
Elongate supralabial below eye, fourth (1) or fifth (0) L&R | / | / | / | 0&0 | 0&0 | 0&0 | 0&0 | 0&0 | 0&0 | 0&0 | 0&0 | 0&0 | 0&0 |
Mensural (mm) and meristic data for Dravidoseps nilgiriensis comb. nov.. Abbreviations are listed in Materials and Methods except for: L&R = Left & Right; M = male; F= female; Sa = Subadult; * = data incomplete; / = data unavailable, # indicates discrepancy with original description (
Museum number | BNHS 2562 | BNHS 2563 | BNHS 2564 | BNHS 2565 | ZSI-R-28603 | ZSI-R-28604 | ZSI-R-28605 | ZSI-R-28606 | ZSI-R-28607 | ZSI-R-28608 | ZSI-R-28609 | ZSI-R-28694 |
---|---|---|---|---|---|---|---|---|---|---|---|---|
Type | Nontypes | |||||||||||
Sex | Sa | Sa | F | F | F | M | M | Sa | Sa | Sa | Sa | Sa |
SVL | 39.4 | 35.9 | 49.9 | 50.1 | 43.6 | 49.6 | 45.9 | 38.7 | 38.8 | 39.6 | 37.4 | 39.6 |
TL | 5.9* | 40 | 50.2 | 33.4 | 49.5 | 62.4 | 53.7 | 12.2* | 44.6 | 47.4 | 12.4* | 34.8 |
TW | 3.5 | 3.1 | 5.0 | 4.7 | 4.2 | 4.4 | 4.4 | 3.3 | 3.7 | 3.7 | 3.4 | 3.1 |
FL | 2.4 | 1.6* | 2.8 | 3.1 | 2.8 | 3.2 | 2.8 | 2.0* | 2.0 | 2.1 | 2.3 | 2.3 |
CL | 3.5 | 3.1 | 4.3 | 4.1 | 3.7 | 4.3 | 3.7 | 3.1 | 3.1 | 3.2 | 3.3 | 3.3 |
AGL | 21.8 | 20.4 | 30.1 | 29.3 | 24.9 | 28.4 | 25.7 | 23.5 | 24.1 | 25.2 | 22.1 | 22.9 |
BH | 3.8 | 3.2 | 5.0 | 5.3 | 4.5 | 4.7 | 3.8 | 4.7 | 3.7 | 4.2 | 4.4 | 3.5 |
BW | 5.4 | 5.5 | 8.4 | 8.1 | 7.4 | 7.1 | 6.8 | 6.4 | 5.9 | 5.4 | 5.4 | 5.7 |
HL | 6.7 | 6.5 | 8.4 | 8.0 | 7.0 | 8.1 | 7.4 | 6.8 | 6.8 | 7.2 | 6.8 | 6.6 |
HW | 4.4 | 4.3 | 6.4 | 5.7 | 5.4 | 5.6 | 5.4 | 4.5 | 4.8 | 5.1 | 4.3 | 4.5 |
HH | 3.1 | 2.9 | 4.7 | 4.2 | 4.0 | 4.2 | 4.2 | 3.8 | 3.5 | 3.7 | 3.5 | 3.0 |
ED | 1.4 | 1.4 | 1.7 | 1.7 | 1.6 | 1.7 | 1.6 | 1.3 | 1.5 | 1.4 | 1.5 | 1.4 |
TWD | 0.6 | 0.6 | 0.6 | 0.8 | 0.6 | 0.7 | 0.5 | / | 0.7 | 0.6 | 0.6 | 0.7 |
EE | 2.6 | 2.6 | 3.1 | 3.2 | 2.9 | 3.3 | 3.0 | 2.9 | 2.7 | 2.8 | 2.8 | 2.8 |
EL | 0.5 | 0.5 | 0.7 | 0.6 | 0.5 | 0.7 | 0.6 | 0.6 | 0.5 | 0.5 | 0.5 | 0.6 |
ES | 2.7 | 2.5 | 3.2 | 3.2 | 3.1 | 3.4 | 3.1 | 3.0 | 2.8 | 2.9 | 2.9 | 2.6 |
EN | 1.7 | 1.5 | 2.2 | 2.0 | 2.1 | 2.3 | 2.2 | 1.9 | 1.7 | 1.8 | 1.7 | 1.6 |
IN | 1.3 | 1.1 | 1.5 | 1.5 | 1.4 | 1.5 | 1.6 | 1.4 | 1.2 | 1.2 | 1.3 | 1.2 |
IO | 2.4 | 2.3 | 3.0 | 3.0 | 2.7 | 3.0 | 2.9 | 2.8 | 2.3 | 2.4 | 2.7 | 2.4 |
Nu | 1&2 | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 |
Sb Nu | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
SL L&R | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 |
IL L&R | 6&6 | 6&6 | 6&6 | 6&6 | 6&6 | 6&6 | 6&6 | 6&6 | 6&6 | 6&6 | 6&6 | 6&6 |
PoSL L&R | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 |
Elo L&R | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 | 2&2 |
PVS | 64 | 65 | 65 | 63 | 65 | 63 | 64 | 62 | 65 | 66 | 62 | 64 |
RBS | 28 | 28 | 28 | 29 | 28 | 28 | 27 | 28 | 27 | 27 | 28 | 29 |
VS | 66 | 61* | 66 | 62 | 62 | 63 | 69 | 64 | 67 | 68 | 67 | 70 |
SPCLR | 9 | 9 | 9 | 10 | 9 | 10 | 9 | 9 | 9 | 8 | 10 | 10 |
RTS | 21 | / | 21 | 20 | / | 19 | 19 | 19 | 19 | 19 | / | 21 |
LamF1 L&R | 5&6 | 6&6 | 5&6 | 5&5 | 6&6 | 7&7 | 6&6 | 6&6 | 6&6 | 6&6 | 5&6 | 5&5 |
LamF4 L&R | 10&9 | 10&10 | 11&11 | 10&10 | 10&11 | 10&10 | 11&11 | 11&11 | 11&11 | 10&11 | 11&10 | 10&9 |
LamT1 L&R | 6&6 | 6&6 | 6&6 | 5&6 | 6&6 | 6&5 | 6&6 | 7&6 | 6&6 | 5&6 | 7&6 | 5&5 |
LamT4 L&R | 14&15 | 14&14 | 14&14 | 15&15 | 14&14 | 15&14 | 14&15 | 15&15 | 15&16 | 14&14 | 15&15 | 13&14 |
Elongate supralabial below eye, fourth (1) or fifth (0) L&R | 0&0 | 0&0 | 0&0 | 0&0 | 0&0 | 0&0 | 0&0 | 0&0 | 0&0 | 0&0 | 0&0 | 0&0 |
Lygosoma pruthi –
NRC-AA-8273 (AK-R 147), adult female, from Pakkamalai Reserve Forest (12.17224°N, 79.31907°E; elevation ca. 400 m asl.), Gingee Hills, Viluppuram District, Tamil Nadu State, India, collected by Akshay Khandekar, Swapnil Pawar and team, on 3rd April 2021.
BNHS 2568 (AK-R 192), adult female, from near Arulmigu Sri Pachaiamman Temple, Vedal (12.37095°N, 79.47239°E; elevation ca. 140 m asl.), Tiruvannamalai
District, Tamil Nadu State, India, same data as holotype except collected on 4th April 2021.
The specific epithet is a toponym for the Gingee Hills in Villupuram District of Tamil Nadu State, the type locality of the new species.
Gingee leaf-litter skink.
A medium-sized skink snout to vent length up to 57 mm (n = 2). Seven supralabials and six or seven infralabials up to angle of mouth; fifth supralabial elongate and below eye; two post-supralabials; eight supraciliaries; a single slightly elongated nuchal on either side, separated by three scales behind parietal; 66 or 67 scales in paravertebral rows; 30–32 scales around mid-body; 67 ventral scales; 12 enlarged precloacal scales; scales on lateral sides of tail base smooth, 21 scales around the tail. Subdigital lamellae unpaired, smooth on manus and smooth to weakly keeled on pes; five or six lamellae under digit I of manus and six under digit I of pes; 11 or 12 lamellae under digit IV of manus and, 17 under digit IV of pes. Dorsum light brown with black markings; thick black stripe from rostrum to tail speckled with light spots; supralabials with white streak; venter glossy grey-white with some darker markings.
Dravidoseps gingeeensis sp. nov. can be diagnosed from known congeners based on the following characters: 12.0 ± 0.00 (12) SPCLR (versus 9.2 ± 0.60 (8–10) in D. nilgiriensis comb. nov., 10.0 ± 0.00 (10) in D. pruthi comb. nov., and 8.3 ± 0.76 (8–10) in D. goaensis comb. nov.); 17.0 ± 0.00 (17) LAM4T (versus 14.4± 0.76 (13–16) in D. nilgiriensis comb. nov., 16.1 ± 1.20 (14–18) in D. pruthi comb. nov., and 13.4 ± 0.79 (13–15) in D. goaensis comb. nov.); a single Nu on either side and three Sb Nu (versus a single NU on either side and Sb NU either absent or one or two presents in D. goaensis comb. nov., and a single NU on either side and Sb NU either absent or rarely only a single present in D. nilgiriensis comb. nov.); presence of unkeeled scales on tail base (versus keeled scales on tail base in D. goaensis comb. nov.); 21 RTS (versus 18 or 19 RTS in D. goaensis comb. nov.). Dravidoseps gingeeensis sp. nov. is diagnosed against the new species described below as part of their respective descriptions.
Adult female (SVL 56.6 mm) in good state of preservation except head and tail tip slightly bent towards left side, and a 3.6 mm long incision at sternum region for liver tissue collection (Fig.
Dravidoseps gingeeensis sp. nov. (holotype, NRC-AA-8273): A dorsal view of body, B ventral view of body, C dorsal view of head, D ventral view of head, E lateral right side view of head, F ventral view of left manus, and G ventral view of left pes. Scale bars: A, B = 10 mm; C–E, G = 5 mm; F = 3 mm; photos by Akshay Khandekar.
Body relatively slender (BW/AGL 0.27), elongate (AGL/SVL = 0.58); dorsal scales on body smooth, cycloid, imbricate; ventrals similar to dorsals except subequal from chest to vent, marginally larger on pectoral and precloacal region; 67 scales in paravertebral rows; 32 scales around mid-body; 67 ventral scales; 12 enlarged precloacal scales (Fig.
Tail half original half regenerated, cylindrical, slightly shorter than snout-vent length (TL/SVL 0.88); dorsal and ventral scales on original tail cycloid, imbricate, similar to those on body dorsum; scales on lateral sides of tail base smooth, 21 scales around the tail; dorsal and ventral scales on regenerated tail similar to those on original tail except for median dorsal and subcaudal scale rows distinctly rectangular and larger than surrounding scales (Fig.
Dorsal ground colouration of body, head and tail light brown with a bronze tint; head with scattered dark markings; dorsal scales of body and tail finely outlined by dark brown, centre of some scales with dark markings forming indistinct stripes; limbs darker than body dorsum and with light spots; a thick dark brown stripe running from rostrum through orbit and onto flank and tail with scattered light spots; supralabials with a white streak; ventral regions glossy, off-white with scattered black and grey markings.
Mensural and meristic data for the adult (SVL 53.6 mm) female paratype (BNHS 2568) are given in Table
Mensural (mm) and meristic data for Dravidoseps gingeeensis sp. nov. and Dravidoseps jawadhuensis sp. nov.. Abbreviations are listed in Materials and Methods except for: L&R = Left & Right; M = male; F = female; Sa = Subadult; * = tail incomplete.
Museum number | NRC-AA-8273 | BNHS 2568 | NRC-AA-8274 | BNHS 2569 |
D. gingeeensis sp. nov. | D. jawadhuensis sp. nov. | |||
Type | Holotype | Paratype | Holotype | Paratype |
Sex | F | F | M | Sa |
SVL | 56.6 | 53.6 | 46.6 | 32.5 |
TL | 50.1 | 21.8* | 13.6* | 24.9* |
TW | 5.9 | 5.1 | 4.3 | 2.6 |
FL | 3.5 | 3.6 | 3.3 | 2.5 |
CL | 4.8 | 4.4 | 4.4 | 3.0 |
AGL | 33.2 | 30.2 | 27.7 | 17 |
BH | 5.8 | 4.6 | 4.6 | 3.2 |
BW | 9.1 | 8.8 | 7.6 | 5.4 |
HL | 9.0 | 9.0 | 7.6 | 6.3 |
HW | 6.5 | 6.3 | 5.9 | 4.4 |
HH | 5.3 | 4.2 | 4.2 | 3.1 |
ED | 1.9 | 1.9 | 1.7 | 1.4 |
TWD | 0.9 | 0.8 | 0.8 | 0.7 |
EE | 3.4 | 3.4 | 3.0 | 2.6 |
EL | 0.7 | 0.7 | 0.6 | 0.5 |
ES | 3.9 | 3.6 | 3.4 | 2.7 |
EN | 2.6 | 2.3 | 2.2 | 1.7 |
IN | 1.4 | 1.5 | 1.4 | 1.2 |
IO | 3.5 | 3.3 | 3.3 | 2.6 |
Nu | 1&1 | 1&1 | 1&1 | 2&2 |
Sb Nu | 3 | 3 | 0 | 0 |
SL L&R | 7&7 | 7&7 | 7&7 | 7&7 |
IL L&R | 6&6 | 7&7 | 6&6 | 6&6 |
PoSL L&R | 2&2 | 2&2 | 2&2 | 2&2 |
Elo L&R | 2&2 | 2&2 | 3&3 | 2&2 |
PVS | 67 | 66 | 65 | 66 |
RBS | 32 | 30 | 30 | 32 |
VS | 67 | 67 | 68 | 66 |
SPCLR | 12 | 12 | 13 | 12 |
RTS | 21 | 21 | 22 | 23 |
LamF1 L&R | 6&6 | 5&5 | 6&6 | 7&6 |
LamF4 L&R | 11&11 | 11&12 | 11&11 | 11&11 |
LamT1 L&R | 6&6 | 6&6 | 6&5 | 6&6 |
LamT4 L&R | 17&17 | 17&17 | 17&17 | 16&16 |
Elongate supralabial below eye, fourth (1) or fifth (0) L&R | 0&0 | 0&0 | 0&0 | 0&0 |
Dravidoseps gingeeensis sp. nov. is known from its type locality (Pakkamalai Reserve Forest in Viluppuram District; 400 m asl.) and paratype locality (Arulmigu Sri Pachaiamman Temple, near Vedal, Tiruvannamalai District; 140 m asl.), both in north-eastern Tamil Nadu, < 30 km apart from each other in aerial distance (Fig.
Viviparous, litter size four (two pairs of embryos in early stages of development in holotype NRC-AA-8273 (Fig.
Lygosoma cf. pruthi –
Lygosoma pruthi –
Subdoluseps pruthi –
NRC-AA-8274 (CES 09/930), adult male, from near Beeman falls (12.60174°N, 78.84590°E; elevation ca. 450 m asl.), Jawadhu Hills, Vellore District, Tamil Nadu State, India, collected by Ishan Agarwal and team on 12th July 2009.
BNHS 2569 (AK 850), subadult, from Beeman falls car parking (12.60513°N, 78.86947°E; elevation ca. 580 m asl.), same data as holotype except collected by Akshay Khandekar, Ishan Agarwal, Swapnil Pawar, Tejas Thackeray and team on 4th June 2019.
The specific epithet is a toponym for the Jawadhu Hills in Vellore District of Tamil Nadu State, the type and currently only known locality for the new species.
Jawadhu leaf-litter skink.
A medium-sized skink snout to vent length up to 47 mm (n = 2). Seven supralabials and six infralabials up to angle of mouth; fifth supralabial elongate and below eye; two post-supralabials; seven or eight supraciliaries; one or two elongated nuchals on either side, in contact with each other behind parietal; 65 or 66 scales in paravertebral rows; 30–32 scales around mid-body; 66–68 ventral scales; 12 or 13 enlarged precloacal scales; scales on lateral sides of tail base smooth, 22 or 23 scales around the tail. Subdigital lamellae unpaired, smooth on manus and smooth to weakly keeled on pes; six or seven lamellae under digit I of manus and five or six under digit I of pes; 11 lamellae under digit IV of manus and, 16 or 17 under digit IV of pes. Dorsum dark brown with black markings; thick black stripe from rostrum to tail speckled with light spots; males with yellow on lower parts of forebody and flanks; supralabials with white streak; venter glossy off-white with some darker markings.
Dravidoseps jawadhuensis sp. nov. can be diagnosed from known congeners based on the following characters: five PoSbO on each side (versus three or four in Dravidoseps gingeeensis sp. nov., four (rarely three or five on one side) in D. nilgiriensis comb. nov., four on each side in D. goaensis comb. nov. and in D. pruthi comb. nov.); 12.5 ± 0.71 (12–13) SPCLR (versus 9.2 ± 0.60 (8–10) in D. nilgiriensis comb. nov., 10.0 ± 0.00 (10) in D. pruthi comb. nov., and 8.3 ± 0.76 (8–10) in D. goaensis comb. nov.); presence of unkeeled scales on tail base (versus keeled scales on tail base in D. goaensis comb. nov.); two PoSL on either side (versus single on either in D. pruthi comb. nov.); one or two Nu on either side and Sb Nu absent (versus a single Nu on either side and three Sb Nu in D. gingeeensis sp. nov.); 22 or 23 RTS (versus 21 RTS in D. gingeeensis sp. nov.). Dravidoseps jawadhuensis sp. nov. is diagnosed against the new species described below as part of their respective descriptions.
Adult male (SVL 45.7 mm) in good state of preservation except more than half of the tail missing (Fig.
Dravidoseps jawadhuensis sp. nov. (holotype, NRC-AA-8274): A dorsal view of body, B ventral view of body, C dorsal view of head, D ventral view of head, E lateral right side view of head, F ventral view of left manus, and G ventral view of left pes. Scale bars: A, B = 10 mm; C–E, G = 5 mm; F = 3 mm; photos by Akshay Khandekar.
Body relatively slender (BW/AGL 0.27), elongate (AGL/SVL = 0.59); dorsal scales on body smooth, cycloid, imbricate; ventrals similar to dorsals except subequal from chest to vent, marginally larger on pectoral and precloacal region; 65 scales in paravertebral rows; 30 scales around mid-body; 68 ventral scales; 13 enlarged precloacal scales (Fig.
Tail original, cylindrical, more than half broken and lost; dorsal and ventral scales smooth, cycloid, imbricate, similar to those on body dorsum; scales on lateral tail base smooth, 22 scales around the tail (Fig.
Dorsal ground colouration of body, head and tail dark brown; head with a few dark blotches on and between supraoculars; dorsal scales of body and tail finely outlined by dark brown, centre of scales with dark markings forming indistinct stripes; limbs darker than body dorsum and with light spots; a thick dark black stripe running from rostrum through orbit and onto flank and tail with scattered light spots; supralabials with a white streak; two or three rows of scales below the dark band between ear opening and mid-body yellow; ventral regions glossy cream with fine dark stripes.
Mensural and meristic data for the subadult paratype (SVL = 32.5 mm) is given in Table
Dravidoseps jawadhuensis sp. nov. is known only from the type locality (in and around Beeman falls), Jawadhu Hills in Vellore District, Tamil Nadu, India (Fig.
Unknown, there are no females in the type series.
We found the following discrepancies in mensural and meristic characters of specimen CES 09/930 as against the data provided by
NRC-AA-8275 (AK-R 984), adult male, from near Wood House, Talayanai road, (8.52200°N, 77.50403°E; elevation ca. 200 m asl.), Kalakadu Reserve Forest, Kalakad-Mundanthurai Tiger Reserve (KMTR), Tirunelveli District, Tamil Nadu State, India, collected by Akshay Khandekar, Ishan Agarwal, Swapnil Pawar and team, on 30th March 2022.
ZSI-R-28614 (AK-R 982), adult male, ZSI-R-28615 (AK-R 983) adult female, same data as holotype; NRC-AA-8278 (AK-R 666), adult male, BNHS 2829 (AK-R 667), ZSI-R-28613 (AK-R 981), adult females, from below Sengaltheri (8.52824°N, 77.47968°E; elevation ca. 400 m asl.), collected by Akshay Khandekar, Swapnil Pawar and team on 4th May 2021; NRC-AA-8276 (AK-R 605), adult male, NRC-AA-8277 (AK-R 606), subadult, from Therku Viravallanur Reserve Forest (8.57553°N, 77.53916°E; elevation ca. 400 m asl.) collected by Akshay Khandekar, Swapnil Pawar and team on 5th May 2021; BNHS 2830 (AK-R 700), BNHS 2831 (AK-R 701), adult males from near Kodumudiyaru dam (8.43122°N, 77.52425°E; elevation ca. 400 m asl.), Thirukkurungudi Reserve Forest, collected by Akshay Khandekar, Swapnil Pawar and team on 8th May 2021; all from KMTR, Tirunelveli District, Tamil Nadu State, India.
The specific epithet is a toponym for Kalakad in Kalakad-Mundanthurai Tiger Reserve (KMTR), Tirunelveli District of Tamil Nadu State, the type locality of the new species.
KMTR leaf-litter skink.
A medium-sized skink snout to vent length up to 55.7 mm (n = 10). Six or seven supralabials and six infralabials up to angle of mouth; fourth supralabial elongate and below eye (rarely fifth on both sides, n = 1/10 or and fifth only on one side, n = 3/10); two post-supralabials (rarely single on one side, n = 2/10); seven supraciliaries; one elongated nuchal on either side (rarely two on one side, n = 2/10), in contact with each other behind parietal; 63–66 scales in paravertebral rows; 28 scales around mid-body; 64–71 ventral scales; eight enlarged precloacal scales; scales on lateral sides of tail base smooth, 18 or 19 scales around the tail. Subdigital lamellae unpaired, smooth on manus and smooth to weakly keeled on pes; five lamellae under digit I of manus (rarely four on one of the side, n = 1/10); five or six under digit I of pes; 10 or 11 lamellae under digit IV of manus (rarely nine on one of the side, n = 1/10); and 14–16 under digit IV of pes. Dorsum coconut brown with black markings; thick brown stripe from rostrum to tail speckled with light spots; supralabials with white streak; males with yellow on lower parts of forebody and flanks extending onto belly; venter glossy grey-white without darker markings.
Dravidoseps kalakadensis sp. nov. can be diagnosed from known congeners based on the following characters: 28.0 ± 0.00 (28) RBS (versus 30.0 ± 0.00 (30) in D. pruthi comb. nov., and 31.0 ± 1.41 (30–32) in D. gingeeensis sp. nov. and in D. jawadhuensis sp. nov.); 8.0 ± 0.00 (8) SPCLR (versus 12.0 ± 0.00 (12) in D. gingeeensis sp. nov., 12.5 ± 0.71 (12–13) in D. jawadhuensis sp. nov., 9.2 ± 0.60 (8–10) in D. nilgiriensis comb. nov., 10.0 ± 0.00 (10) SPCLR in D. pruthi comb. nov., and 8.3 ± 0.76 (8–10) in D. goaensis comb. nov.); 18.7 ± 0.52 (18–19) RTS (versus 21.0 ± 0.00 (21) in D. gingeeensis sp. nov., 22.5 ± 0.71 (22–23) in D. jawadhuensis sp. nov., 20.1 ± 1.07 (19–22) in D. nilgiriensis comb. nov., and 21.4 ± 0.89 (21–23) in D. pruthi comb. nov.); six SL (rarely seven on just one specimen on both sides and on three specimens on one side) (versus seven SL in D. pruthi comb. nov., D. nilgiriensis comb. nov., D. gingeeensis sp. nov., and D. jawadhuensis sp. nov.); SL IV elongate and below eye (rarely SL V elongate and below eye, on just one specimen on either side and on three specimens on one side) (versus SL V elongate and below eye in D. pruthi comb. nov., D. nilgiriensis comb. nov., D. gingeeensis sp. nov., D. jawadhuensis sp. nov., and in D. goaensis comb. nov. (SL IV elongate and below eye only on two specimens on one side)); a single (rarely two on one side) Nu on either side and Sb Nu absent (versus a single Nu on either side and two or three Sb Nu present in D. pruthi comb. nov., and a single Nu on either side and three Sb Nu in D. gingeeensis sp. nov.); presence of unkeeled scales on tail base (versus keeled scales on tail base in D. goaensis comb. nov.). Dravidoseps kalakadensis sp. nov. is diagnosed against the new species described below as part of their respective descriptions.
Adult male (SVL 45.7 mm) in good state of preservation except body and tail tip slightly bent towards left side, tail slightly detached at its half-length from ventral side, and hemipenis everted partially on left and entirely on right (Fig.
Dravidoseps kalakadensis sp. nov. (holotype, NRC-AA-8275): A dorsal view of body, B ventral view of body, C dorsal view of head, D ventral view of head, E lateral right side view of head, F ventral view of left manus, and G ventral view of left pes. Scale bars: A, B = 10 mm; C–E, G = 5 mm; F = 3 mm; photos by Akshay Khandekar.
Body relatively slender (BW/AGL 0.26), elongate (AGL/SVL = 0.57); dorsal scales on body smooth, cycloid, imbricate; ventrals similar to dorsals except subequal from chest to vent, marginally larger on pectoral and precloacal region; 63 scales in paravertebral rows; 28 scales around mid-body; 66 ventral scales; eight enlarged precloacal scales (Fig.
Tail original, entire, cylindrical, slightly longer than snout-vent length (TL/SVL 1.14); dorsal and ventral scales cycloid, imbricate, similar to those on body dorsum except for median dorsal and median subcaudal scale rows somewhat larger than surrounding scales on tail; scales on lateral sides of the base tail base smooth, 19 scales around the tail counted (Fig.
Dorsal ground colouration of body, head and tail dull coconut brown; head with scattered dark markings; head with a large dark blotch on the frontonasal; dorsal scales of body and tail finely outlined by dark brown, centre of scales with dark markings forming indistinct stripes, more prominent on tail; limbs darker than body dorsum and with light spots; a thick dark brown stripe running from rostrum through orbit and onto flank and tail with scattered light spots; supralabials with a white streak; yellow markings below dark stripe from throat to hindlimb insertions extending onto belly; ventral regions glossy grey-white.
Mensural and meristic data for the paratype series are given in Table
Mensural (mm) and meristic data for Dravidoseps kalakadensis sp. nov.. Abbreviations are listed in Materials and Methods except for: L&R = Left & Right; M = male; F = female; Sa = Subadult; * = tail and lamellae incomplete; and / = data unavailable.
Museum number | NRC-AA-8275 | NRC-AA-8276 | NRC-AA-8277 | NRC-AA-8278 | BNHS 2829 | BNHS 2830 | BNHS 2831 | ZSI-R-28613 | ZSI-R-28614 | ZSI-R-28615 |
Type | Holotype | Paratypes | ||||||||
Sex | M | M | Sa | M | F | M | M | F | M | F |
SVL | 45.7 | 46.5 | 38.3 | 46.6 | 49.4 | 50.8 | 43.6 | 56.0 | 50.5 | 50.0 |
TL | 52.1 | 52.8 | 43.8 | 32.9 | 41.4 | 40.9 | 30.7 | 29.9 | 39.7 | 7.8* |
TW | 4.5 | 3.7 | 3.5 | 4.6 | 4.6 | 5.2 | 3.6 | 5.2 | 4.4 | 4.7 |
FL | 2.7 | 3.2 | 2.5 | 2.9 | 2.9 | 3.1 | 2.9 | 3.5 | 2.9 | 2.9 |
CL | 3.9 | 4.0 | 3.3 | 3.9 | 3.9 | 4.2 | 3.6 | 4.1 | 4.6 | 3.6 |
AGL | 26.5 | 26.9 | 21.1 | 26.9 | 29.0 | 30.7 | 25.5 | 36.4 | 30 | 30 |
BH | 5.5 | 3.6 | 2.7 | 5.0 | 5.5 | 4.4 | 3.2 | 7.2 | 5.7 | 5.1 |
BW | 7.0 | 6.8 | 5.8 | 6.6 | 6.7 | 7.9 | 5.9 | 10.1 | 7.9 | 8.0 |
HL | 7.7 | 7.6 | 7.1 | 8.4 | 7.5 | 8.8 | 7.6 | 8.4 | 9.0 | 7.5 |
HW | 5.6 | 5.5 | 4.6 | 5.8 | 5.8 | 6.4 | 5.1 | 6.1 | 6.2 | 4.9 |
HH | 4.1 | 3.5 | 3.3 | 4.2 | 3.5 | 4.3 | 3.5 | 4.4 | 4.1 | 3.5 |
ED | 1.7 | 1.6 | 1.5 | 1.6 | 1.5 | 1.7 | 1.6 | 1.7 | 1.7 | 1.6 |
TWD | 0.7 | 0.7 | 0.7 | 0.7 | 0.7 | 0.7 | 0.7 | 0.7 | 0.8 | 0.7 |
EE | 3.3 | 2.7 | 2.7 | 3.3 | 2.8 | 3.5 | 2.9 | 3.5 | 3.6 | 3.1 |
EL | 0.7 | 0.7 | 0.4 | 0.5 | 0.6 | 0.6 | 0.7 | 0.5 | 0.7 | 0.6 |
ES | 3.2 | 3.0 | 2.7 | 3.3 | 3.1 | 3.6 | 3.1 | 3.3 | 3.4 | 3.1 |
EN | 2.0 | 1.9 | 1.6 | 2.3 | 1.9 | 2.2 | 1.9 | 2.2 | 2.0 | 1.9 |
IN | 1.5 | 1.3 | 1.3 | 1.5 | 1.3 | 1.5 | 1.3 | 1.4 | 1.6 | 1.3 |
IO | 2.8 | 3.0 | 2.7 | 3.1 | 3.0 | 3.3 | 2.9 | 3.2 | 3.1 | 2.7 |
Nu | 1&1 | 1&1 | 2&1 | 1&1 | 1&1 | 1&1 | 1&1 | 1&2 | 1&1 | 1&1 |
Sb Nu | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
SL L&R | 6&6 | 6&6 | 7&6 | 6&7 | 6&6 | 6&6 | 6&6 | 7&7 | 6&6 | 7&6 |
IL L&R | 6&6 | 6&6 | 6&6 | 6&6 | 6&6 | 6&6 | 6&6 | 6&6 | 6&6 | 6&6 |
PoSL L&R | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&1 | 2&1 | 2&2 | 2&2 | 2&2 |
Elo L&R | 1&1 | 1&1 | 2&2 | 1&1 | 1&1 | 1&1 | 1&2 | 1&1 | 1&1 | 1&1 |
PVS | 63 | 65 | 66 | 64 | 64 | 65 | 64 | 64 | 66 | 65 |
RBS | 28 | 28 | 28 | 28 | 28 | 28 | 28 | 28 | 28 | 28 |
VS | 66 | 68 | 68 | 64 | 71 | 67 | 65 | 70 | 68 | 68 |
SPCLR | 8 | 8 | 8 | 8 | 8 | 8 | 8 | 8 | 8 | 8 |
RTS | 19 | 18 | / | 19 | 19 | 18 | / | / | 19 | / |
LamF1 L&R | 4&5 | 5&5 | 5&5 | 4*&5 | 5&5 | 5&5 | 5&5 | 5&5 | 5&5 | 5&5 |
LamF4 L&R | 10&10 | 10&10 | 10&11 | 8*&9* | 10&11 | 10&5* | 10&10 | 9&10 | 10&10 | 10&10 |
LamT1 L&R | 6&6 | 5&5 | 6&5 | 5&5 | 5&5 | 6&5 | 6&6 | 5&6 | 6&6 | 6&6 |
LamT4 L&R | 16&16 | 14&15 | 15&15 | 15&15 | 15&15 | 15&15 | 15&14 | 15&14 | 15&15 | 14&15 |
Elongate supralabial below eye, fourth (1) or fifth (0) L&R | 1&1 | 1&1 | 0&1 | 1&0 | 1&1 | 1&1 | 1&1 | 0&0 | 1&1 | 0&1 |
Dravidoseps kalakadensis sp. nov. is known only from a few closely spaced localities (< 20 km in aerial distance) on the eastern slopes of the southern Western Ghats in Kalakad-Mundanthurai Tiger Reserve (Fig.
Viviparous, litter size two or three. ZSI-R-28613, three embryos in late stages of development; ZSI-R-28615, two embryos in late stages of development; and BNHS 2829, two embryos in early stages of development (Fig.
NRC-AA-8279 (AK-R 1344), adult male, from near Ayyanar Kovil Falls (9.51294°N, 77.45183°E; elevation ca. 340 m asl.), Srivilliputhur-Megamalai Tiger Reserve (SMTR), Virudhunagar District, Tamil Nadu State, India, collected by Akshay Khandekar, Ishan Agarwal, Swapnil Pawar and team on 16th April 2022.
NRC-AA-8280 (AK-R 1343), NRC-AA-8281 (AK-R 1345), adult females, same data as holotype; NRC-AA-8283 (AK-R 1347), adult male, NRC-AA-8282 (AK-R 1346), NRC-AA-8284 (AK-R 1348), adult females, from near Sri Sastha Kovil, Settur Reserve Forest (9.40362°N, 77.37211°E; elevation ca. 340 m asl.), and NRC-AA-8285 (AK-R 1349), adult female, (9.47178°N, 77.42983°E; elevation ca. 300 m asl.), Madurai District, same collectors as holotype except collected on 17th April 2022; BNHS 2832 (AK-R 1434), BNHS 2833 (AK-R 1435), BNHS 2834 (AK-R 1436), adult females, (9.58131°N, 77.55227°E; elevation ca. 960 m asl.), and BNHS 2835 (AK-R 1455), adult female, from Shenbagathoppu (9.55173°N, 77.55445°E; elevation ca. 200 m asl.), Virudhunagar District, same collectors as holotype except collected on 20th April 2022; BNHS 2836 (AK-R 1489), BNHS 2837 (AK-R 1490), BNHS 2838 (AK-R 1491), adult females, from near Atthi Kovil (9.59990°N, 77.53374°E; elevation ca. 200 m asl.), Virudhunagar District, same collectors as holotype except collected on 25th April 2022; BNHS 2839 (AK-R 1492), ZSI-R-28616 (AK-R 1493), ZSI-R-28617 (AK-R 1516), adult females, from near Sathuragiri Falls (9.70927°N, 77.63074°E; elevation ca. 240 m asl.), Madurai District, same collectors as holotype except collected on 26th April 2022; ZSI-R-28618 (AK-R 1716), from near Chinnasurli Falls, Megamalai (9.70961°N, 77.42213°E; elevation ca. 610 m asl.), Theni District, same collectors as holotype except collected on 4th May 2022; ZSI-R-28619 (AK-R 1761), ZSI-R-28620 (AK-R 1762), subadults, from near Megamalai Viewpoint (9.72559°N, 77.41983°E; elevations ca. 1000 m asl.), Theni District, same collectors as holotype except collected on 8th May 2022; all from SMTR, Tamil Nadu State, India.
AK-R-1717, same collection data as ZSI-R-28618 (AK-R 1716).
The specific epithet is a toponym for Srivilliputhur in Srivilliputhur-Megamalai Tiger Reserve (SMTR), Virudhunagar District of Tamil Nadu State, the type locality of the new species.
SMTR leaf-litter skink.
A medium-sized skink snout to vent length up to 56 mm (n = 20). Seven supralabials (rarely six on one of the side, n = 1/20) and six infralabials (rarely seven on one of the side, n = 1/20) up to angle of mouth; fifth supralabial elongate and below eye (rarely fourth on one of the side, n = 1/20); two post-supralabial; seven supraciliaries (rarely six or eight n = 1 each/20); one elongated nuchal on either side (rarely two, n = 3/20), in median contact behind parietal (rarely separated by one or two scales, n = 5/20); 63–66 scales in paravertebral rows; 26–28 scales around mid-body (rarely 29, n = 1/20); 62–68 ventral scales (rarely 70, n = 1/20); 8–10 enlarged precloacal scales; scales on lateral sides of tail base smooth, 19–21 scales around the tail. Subdigital lamellae unpaired, mostly smooth; five or six lamellae under digit I of manus and pes; 9–11 lamellae under digit IV of manus (rarely 12, n = 1/20); and 13–16 under digit IV of pes (rarely 12, 17; n = 1/20). Dorsum bronze-brown with black markings; thick brown stripe from rostrum to tail speckled with light spots; supralabials with white streak; males with yellow on lower parts of forebody and flanks extending onto belly; venter glossy grey-white without darker markings.
Dravidoseps srivilliputhurensis sp. nov. can be diagnosed from known congeners based on the following characters: 27.8 ± 0.79 (26–29) RBS (versus 31.0 ± 1.41 (30–32) in D. gingeeensis sp. nov. and D. jawadhuensis sp. nov., 28.1 ± 0.86 (26–30) in D. nilgiriensis comb. nov., 30.0 ± 0.00 (30) in D. pruthi comb. nov., and 29.0 ± 1.00 (28–30) in D. goaensis comb. nov.); 14.8 ± 0.97 (13–17) Lam4T (versus 17.0 ± 0.00 (17) in D. gingeeensis sp. nov., 16.5 ± 0.71 (16–17) in D. jawadhuensis sp. nov., 16.1 ± 1.20 (14–18) in D. pruthi comb. nov., and 13.4 ± 0.79 (13–15) in D. goaensis comb. nov.); 9.2 ± 0.77 (8–10) SPCLR (versus 10.0 ± 0.00 (10) SPCLR in D. pruthi comb. nov., and 8.3 ± 0.76 (8–10) in D. goaensis comb. nov.); 20.3 ± 0.78 (19–21) RTS (versus 21.4 ± 0.89 (21–23) in D. pruthi comb. nov.); Elo two or three (rarely one, on just one individual on one side) (versus one or two Elo in D. kalakadensis sp. nov., one Elo (rarely two in 3/22 individuals) in D. nilgiriensis comb. nov.); seven SL (rarely six on one side in 1/20 specimens) (versus six SL (seven on both sides in one specimen and on one side in three specimens) in D. kalakadensis sp. nov.); SL V elongate and below eye (rarely IV elongated and below eye, on one side in 1/ 20 individuals) (versus SL IV elongate and below eye (rarely SL V elongate and below eye, on just one specimen on either side and on three specimens on one side) in D. kalakadensis sp. nov.); presence of unkeeled scales on tail base (versus keeled scales on tail base in D. goaensis comb. nov.). Dravidoseps srivilliputhurensis sp. nov. is diagnosed against the new species described below as part of their respective descriptions.
Adult male (SVL 44.5 mm) in good state of preservation except body bent towards right and tail curved towards left side, a 3.7 mm long incision at marginally above the mid-body ventral for liver tissue collection, and hemipenis partially everted only on right side (Fig.
Dravidoseps srivilliputhurensis sp. nov. (holotype, NRC-AA-8279): A dorsal view of body, B ventral view of body, C dorsal view of head, D ventral view of head, E lateral right side view of head, F ventral view of left manus, and G ventral view of left pes. Scale bars: A, B = 10 mm; C–E, G = 5 mm; F = 3 mm; photos by Akshay Khandekar.
Body relatively slender (BW/AGL 0.25), elongate (AGL/SVL = 0.60); dorsal scales on body smooth, cycloid, imbricate; ventrals similar to dorsals except subequal from chest to vent, marginally larger on pectoral and precloacal region; 64 scales in paravertebral rows; 28 scales around mid-body; 66 ventral scales; 10 enlarged precloacal scales (Fig.
Tail original except tip which is regenerated, entire, cylindrical, equal to snout-vent length (TL/SVL 1.02); dorsal and ventral scales cycloid, imbricate, similar to those on body dorsum except for median dorsal and subcaudal scale rows somewhat larger than surrounding scales on tail, ending in a pointed scute; scales on lateral sides of tail base smooth, 21 scales around the tail (Fig.
Dorsal ground colouration of body, head and tail dull bronze-brown; head with scattered dark markings; dorsal scales of body and tail finely outlined by dark brown, centre of scales with black markings forming indistinct stripes; limbs darker than body dorsum and with light spots; a thick dark brown stripe running from rostrum through orbit and onto flank and tail with scattered light spots bordered dorsally by a fine white stripe; yellow markings below dark stripe from throat to hindlimb insertions extending onto belly; yellow markings below dark stripe from throat to hindlimb insertions extending onto belly; supralabials with a white streak; ventral regions glossy grey-white without darker markings.
Mensural and meristic data for the paratype series are given in Table
Mensural (mm) and meristic data for Dravidoseps srivilliputhurensis sp. nov.. Abbreviations are listed in Materials and Methods except for: L&R = Left & Right; M = male; F = female; Sa = Subadult; * = tail and lamellae incomplete; and / = data unavailable.
Museum number | NRC-AA-8279 | NRC-AA-8280 | NRC-AA-8281 | NRC-AA-8282 | NRC-AA-8283 | NRC-AA-8284 | NRC-AA-8285 | BNHS 2832 | BNHS 2833 | BNHS 2834 |
Type | Holotype | Paratypes | ||||||||
Sex | M | F | F | F | M | F | F | F | F | F |
SVL | 44.5 | 43.3 | 54.7 | 51.0 | 47.5 | 55.6 | 48.2 | 55.5 | 50.4 | 52.3 |
TL | 45.8 | 47.1 | 41.0 | 55.2 | 42.9 | 36.2 | 37.3 | 33.8 | 6.1* | 34 |
TW | 4.1 | 3.7 | 4.6 | 3.9 | 3.9 | 5.0 | 4.4 | 4.9 | 4.4 | 4.4 |
FL | 2.9 | 2.9 | 2.8 | 2.7 | 2.7 | 3.3 | 2.8 | 3.3 | 3.1 | 3.0 |
CL | 4.0 | 4.0 | 4.3 | 3.8 | 4.3 | 4.3 | 3.8 | 4.2 | 4.0 | 3.9 |
AGL | 26.7 | 23.4 | 34 | 30.7 | 28.0 | 34.8 | 28.8 | 34.2 | 31.6 | 34 |
BH | 5.3 | 4.4 | 5.1 | 4.6 | 7.8 | 7.6 | 5.5 | 5.4 | 4.8 | 7.3 |
BW | 6.8 | 6.4 | 9.3 | 8.1 | 8.3 | 9.8 | 7.6 | 9.3 | 7.7 | 10.4 |
HL | 7.6 | 7.4 | 8.6 | 7.9 | 8.8 | 8.3 | 7.6 | 8.9 | 8.2 | 8.8 |
HW | 5.1 | 5.1 | 5.6 | 5.5 | 5.7 | 5.7 | 5.3 | 5.9 | 5.1 | 5.6 |
HH | 3.6 | 3.5 | 4.0 | 3.7 | 4.5 | 4.4 | 3.6 | 4.0 | 4.1 | 4.3 |
ED | 1.6 | 1.6 | 1.6 | 1.7 | 1.6 | 1.6 | 1.6 | 1.7 | 1.6 | 1.7 |
TWD | 0.7 | 0.7 | 0.8 | 0.8 | 0.8 | 0.8 | 0.8 | 0.7 | 0.7 | / |
EE | 3.6 | 2.9 | 3.3 | 3.3 | 3.3 | 3.6 | 3.0 | 3.4 | 3.1 | 3.3 |
EL | 0.9 | 0.6 | 0.5 | 0.6 | 0.7 | 0.6 | 0.7 | 0.6 | 0.7 | 0.6 |
ES | 3.4 | 3.2 | 3.3 | 3.3 | 3.2 | 3.5 | 3.1 | 3.5 | 3.1 | 3.3 |
EN | 2.4 | 2.0 | 2.2 | 2.2 | 2.1 | 2.1 | 2 | 2.2 | 2.0 | 2.2 |
IN | 1.5 | 1.4 | 1.5 | 1.4 | 1.5 | 1.5 | 1.5 | 1.5 | 1.5 | 1.5 |
IO | 2.9 | 2.5 | 3.0 | 2.8 | 3.1 | 2.8 | 2.9 | 3.1 | 2.6 | 3.0 |
Nu | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 | 2&1 |
Sb Nu | 1 | 2 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 |
SL L&R | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 |
IL L&R | 6&6 | 6&6 | 6&6 | 6&6 | 6&6 | 6&6 | 6&6 | 6&6 | 6&6 | 6&6 |
PoSL L&R | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 |
Elo L&R | 2&2 | 2&3 | 2&2 | 2&3 | 2&2 | 1&2 | 2&2 | 3&3 | 3&2 | 2&3 |
PVS | 64 | 66 | 64 | 65 | 65 | 66 | 65 | 64 | 66 | 64 |
RBS | 28 | 28 | 28 | 28 | 28 | 26 | 28 | 28 | 28 | 26 |
VS | 66 | 66 | 66 | 70 | 64 | 64 | 67 | 64 | 65 | 65 |
SPCLR | 10 | 8 | 9 | 9 | 10 | 9 | 9 | 10 | 9 | 10 |
RTS | 21 | 21 | 21 | 21 | 21 | 19 | / | / | / | 21 |
LamF1 L&R | 5&5 | 5&5 | 6&6 | 5&5 | 5&5 | 5&6 | 6&5 | 6&6 | 6&5 | 5&6 |
LamF4 L&R | 11&10 | 10&10 | 4*&11 | 11&10 | 10&10 | 10&10 | 11&11 | 11&11 | 11&9 | 9&9 |
LamT1 L&R | 5&5 | 5&5 | 5&6 | 6&5 | 5&5 | 6&6 | 6&5 | 5&6 | 5&5 | 5&5 |
LamT4 L&R | 16&15 | 16&16 | 16&16 | 14&15 | 14&14 | 15&15 | 17&16 | 14&13 | 14&13 | 14&14 |
Elongate supralabial below eye, fourth (1) or fifth (0) L&R | 0&0 | 0&0 | 0&0 | 0&0 | 0&0 | 0&0 | 0&0 | 0&0 | 0&0 | 0&0 |
Mensural (mm) and meristic data for Dravidoseps srivilliputhurensis sp. nov.. Abbreviations are listed in Materials and Methods except for: L&R = Left & Right; M = male; F = female; Sa = Subadult; * = tail and lamellae incomplete; and / = data unavailable.
Museum number | BNHS 2835 | BNHS 2836 | BNHS 2837 | BNHS 2838 | BNHS 2839 | ZSI-R-28616 | ZSI-R-28617 | ZSI-R-28618 | ZSI-R-28619 | ZSI-R-28620 |
---|---|---|---|---|---|---|---|---|---|---|
Type | Paratypes | |||||||||
Sex | F | F | F | F | F | F | F | F | Sa | Sa |
SVL | 53.4 | 44.4 | 48.5 | 43.1 | 52.9 | 43.1 | 46.1 | 46.4 | 32.0 | 31.8 |
TL | 43.2 | 34.6 | 37 | 40.3 | 35.8 | 23.4 | 19.9* | 44.7 | 24.4* | 32.3 |
TW | 4.4 | 3.4 | 4.0 | 3.5 | 5.0 | 3.6 | 4.0 | 3.8 | 3.3 | 2.5 |
FL | 3.2 | 2.3 | 2.5 | 2.6 | 2.9 | 2.8 | 3.1 | 2.6 | 2.2 | 2.0* |
CL | 4.1 | 3.4 | 3.6 | 3.7 | 4.0 | 3.8 | 4.0 | 3.7 | 3.3 | 2.5 |
AGL | 32.9 | 25.1 | 27.6 | 25.2 | 31.5 | 26.4 | 26.9 | 27.5 | 18.0 | 17.2 |
BH | 6.7 | 3.6 | 6.4 | 4.3 | 5.1 | 4.5 | 5.0 | 4.8 | 3.2 | 4.2 |
BW | 8.8 | 5.6 | 8.4 | 6.4 | 9.2 | 6.3 | 7.8 | 6.6 | 5.7 | 4.7 |
HL | 8.6 | 7.8 | 8.1 | 7.7 | 7.6 | 7.2 | 8.1 | 7.8 | 6.0 | 6.3 |
HW | 5.8 | 4.8 | 5.5 | 4.7 | 5.6 | 4.8 | 5.2 | 5.0 | 5.0 | 4.1 |
HH | 4.1 | 3.3 | 3.5 | 3.4 | 4.2 | 3.6 | 3.7 | 3.2 | 3.1 | 2.6 |
ED | 1.6 | 1.5 | 1.6 | 1.5 | 1.6 | 1.4 | 1.5 | 1.6 | 1.4 | 1.3 |
TWD | 0.7 | 0.8 | 0.7 | 0.6 | 0.7 | 0.5 | 0.7 | 0.8 | 0.6 | 0.6 |
EE | 3.4 | 3.0 | 3.2 | 2.9 | 3.6 | 2.9 | 3.2 | 3.0 | 2.5 | 2.5 |
EL | 0.8 | 0.6 | 0.5 | 0.6 | 0.5 | 0.5 | 0.6 | 0.5 | 0.6 | 0.3 |
ES | 3.3 | 2.9 | 3.3 | 2.8 | 3.4 | 2.9 | 3.4 | 3.0 | 2.4 | 2.5 |
EN | 2.0 | 1.9 | 2.2 | 1.9 | 2.2 | 1.8 | 2.2 | 1.9 | 1.6 | 1.5 |
IN | 1.7 | 1.3 | 1.4 | 1.3 | 1.6 | 1.3 | 1.3 | 1.4 | 1.2 | 1.2 |
IO | 3.1 | 2.7 | 2.7 | 2.7 | 2.8 | 2.7 | 2.8 | 2.6 | 2.3 | 2.2 |
Nu | 1&1 | 1&1 | 1&1 | 1&1 | 1&1 | 2&2 | 1&1 | 2&2 | 1&1 | 1&1 |
Sb Nu | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
SL L&R | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 | 7&6 | 7&7 | 7&7 |
IL L&R | 6&6 | 6&6 | 6&6 | 6&6 | 6&6 | 6&6 | 6&6 | 6&7 | 6&6 | 6&6 |
PoSL L&R | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 |
Elo L&R | 2&3 | 2&2 | 3&3 | 2&2 | 2&2 | 3&3 | 2&2 | 2&2 | 2&3 | 3&2 |
PVS | 64 | 63 | 64 | 65 | 65 | 63 | 66 | 63 | 64 | 63 |
RBS | 28 | 26 | 29 | 28 | 28 | 28 | 28 | 28 | 28 | 28 |
VS | 62 | 66 | 67 | 68 | 67 | 66 | 66 | 63 | 68 | 64 |
SPCLR | 10 | 8 | 8 | 9 | 10 | 9 | 9 | 8 | 10 | 10 |
RTS | 19 | 20 | 20 | 20 | / | 20 | / | / | / | / |
LamF1 L&R | 6&6 | 6&6 | 5&5 | 5&5 | 6&6 | 5&5 | 5&5 | 5&5 | 6&6 | 6&6 |
LamF4 L&R | 11&11 | 10&10 | 10&10 | 10&10 | 10&10 | 11&9 | 11&11 | 10&8* | 11&11 | 12&11 |
LamT1 L&R | 5&5 | 5&5 | 6&6 | 5&6 | 5&5 | 5&5 | 5&6 | 5&5 | 6&6 | 5&5 |
LamT4 L&R | 15&15 | 14&15 | 14&14 | 15&14 | 15&15 | 14&14 | 15&14 | 13&12 | 15&16 | 15&15 |
Elongate supralabial below eye, fourth (1) or fifth (0) L&R | 0&0 | 0&0 | 0&0 | 0&0 | 0&0 | 0&0 | 0&0 | 0&1 | 0&0 | 0&0 |
Dravidoseps srivilliputhurensis sp. nov. is known only from a few closely spaced localities (< 40 km aerial distance between two farthest localities) on the eastern slopes of the Western Ghats in Srivilliputhur-Megamalai Tiger Reserve (Fig.
Viviparous, litter size two or three. NRC-AA-8284, BNHS 2832, BNHS 2835, with three developing embryos; NRC-AA-8281, NRC-AA-8285, BNHS 2834, BNHS 2837, BNHS 2839, ZSI-R-28618 with two developing embryos; BNHS 2838 with two eggs with embryos in early stages of development (Fig.
Lygosoma pruthi –
Subdoluseps pruthi –
NRC-AA-8286 (AK-R 2396), adult female, from near Kambur, Pachaimalai Hills (11.31677°N, 78.60183°E; elevation ca. 850 m asl.), Tiruchirappalli District, Tamil Nadu State, India, collected by Akshay Khandekar, Ishan Agarwal, Swapnil Pawar and team on 22th September 2022.
ZSI-R-28691 (AK-R 2397), subadult, same details as holotype; NRC-AA-8287 (AK 739), adult male, same locality as holotype except collected by Akshay Khandekar, Ishan Agarwal, Swapnil Pawar, Tejas Thackeray and team on 29th May 2019; NRC-AA-8288 (AK 740), BNHS 2857 (AK 741), adult females, BNHS 2858 (AK 742), subadult, from near Pachaimalai Eco Tourism Centre, Pachaimalai Hills (11.31588°N, 78.58103°E; elevation ca. 780 m asl.), collected by Akshay Khandekar, Ishan Agarwal, Swapnil Pawar, Tejas Thackeray and team on 29th May 2019; BNHS 2859 (AK 743), adult female, ZSI-R-28621 (AK 745), adult male, BNHS 2860 (AK 744), subadult, from Pachaimalai Ghat road, Pachaimalai Hills (11.30229°N, 78.57332°E; elevation ca. 600 m asl.), collected by Akshay Khandekar, Ishan Agarwal, Swapnil Pawar, Tejas Thackeray and team on 29th May 2019; ZSI-R-28692 (AK-R 2724), ZSI-R-28693 (AK-R 2725), adult males, from Selur Reserve Forest, Kolli Hills (11.19463°N, 78.37537°E; elevation ca. 400 m asl.), Namakkal District, Tamil Nadu State, India, same collectors as holotype, collected on 12th October 2022; ZSI-R-28695 (AK-R 2734), adult female, from near Madu Falls, Yercaud (11.73881°N, 78.24985°E; elevation ca. 410 m asl.), Salem District, Tamil Nadu State, India, same collectors as holotype, collected on 13th October 2022.
The specific epithet is a toponym for Tamil Nadu State to which the new species is endemic.
Tamil Nadu leaf-litter skink.
A medium-sized skink snout to vent length up to 56 mm (n = 12). Seven supralabials and six (rarely seven, n = 1/12) infralabials up to angle of mouth; fifth supralabial elongate and below eye; two post-supralabials; seven or eight supraciliaries; one or two elongated nuchals on either side, in median contact behind parietal (rarely separated a single scale, n = 1/12); 66–70 scales in paravertebral rows; 28–30 scales around mid-body; 64–71 ventral scales; 10 enlarged precloacal scales; scales on lateral sides of tail base smooth, 20 or 21 scales around the tail. Subdigital lamellae unpaired, smooth on manus and smooth to weakly keeled on pes; five or six lamellae under digit I of manus and pes (rarely seven on manus n = 1/12); 9–11 lamellae under digit IV of manus; and 12–15 under digit IV of pes (rarely 16, n = 1/12). Dorsum dark bronze-brown with black markings; thick black stripe from rostrum to tail speckled with light spots; supralabials with white streak; males with yellow on lower parts of forebody and flanks; venter glossy white with numerous dark reticulations.
Dravidoseps tamilnaduensis sp. nov. can be diagnosed from known congeners based on the following characters: 29.6 ± 0.79 (28–30) RBS (versus 31.0 ± 1.41 (30–32) in D. gingeeensis sp. nov., and D. jawadhuensis sp. nov., 27.8 ± 0.79 (26–29) in D. srivilliputhurensis sp. nov.); 13.7 ± 1.07 (12–15) LAM4T (versus 17.0 ± 0.00 (17) in D. gingeeensis sp. nov., 16.5 ± 0.71 (16–17) in D. jawadhuensis sp. nov., 16.1 ± 1.20 (14–18) in D. pruthi comb. nov.); 10.0 ± 0.00 (10) SPCLR (versus 12.0 ± 0.00 (12) in D. gingeeensis sp. nov., 12.5 ± 0.71 (12–13) in D. jawadhuensis sp. nov., 8.0 ± 0.00 (8) in D. kalakadensis sp. nov., 9.2 ± 0.77 (8–10) in D. srivilliputhurensis sp. nov.); 20.8 ± 0.40 (20–21) RTS (versus 18.7 ± 0.52 (18–19) in D. kalakadensis sp. nov., 22.5 ± 0.71 (22–23) in D. jawadhuensis sp. nov., and 18.7 ± 0.52 (18–19) in D. goaensis comb. nov.); one or two Nu on either side and Sb Nu absent (present in only 1/12 specimens) (versus a single Nu on either side and three Sb Nu present in D. gingeeensis sp. nov., a single Nu on either side and two or three Sb Nu present in D. pruthi comb. nov.); seven SL (versus six SL (seven on just one specimen on either side and on three specimens on one side) in D. kalakadensis sp. nov.); SL V elongate and below eye (versus SL IV elongate and below eye (rarely SL V elongate and below eye, on just one specimen on either side and on three specimens on one side) in D. kalakadensis sp. nov.); two Elo on each side (a single on one side in 1/12 specimens) (versus a single Elo (rarely two in 3/22 individuals) in D. nilgiriensis comb. nov.); 68.0 ± 1.48 (66–70) PVR (versus 64.5 ± 1.05 (63–66) in D. srivilliputhurensis sp. nov.); presence of unkeeled scales on tail base (versus keeled scales on tail base in D. goaensis comb. nov.).
Adult male (SVL 48.5 mm) in good state of preservation except body and tail marginally curved towards left side, and a 3.5 mm long incision in the sternal region for liver tissue collection (Fig.
Dravidoseps tamilnaduensis sp. nov. (holotype, NRC-AA-8286): A dorsal view of body, B ventral view of body, C dorsal view of head, D ventral view of head, E lateral right side view of head, F ventral view of left manus, and G ventral view of left pes. Scale bars: A, B = 10 mm; C–E, G = 5 mm; F = 3 mm; photos by Akshay Khandekar.
Body relatively slender (BW/AGL 0.23), elongate (AGL/SVL = 0.59); dorsal scales on body smooth, cycloid, imbricate; ventrals similar to dorsals except subequal from chest to vent, marginally larger on pectoral and precloacal region; 69 scales in paravertebral rows; 30 scales around mid-body; 70 ventral scales; 10 enlarged precloacal scales (Fig.
Tail original except for tip which is regenerated, entire, cylindrical, slightly shorter than snout-vent length (TL/SVL 0.88); dorsal and ventral scales cycloid, imbricate, similar to those on body dorsum except for median dorsal and subcaudal scale rows distinctly larger than surrounding scales and roughly rectangular on regenerated tip; scales on lateral sides of tail base smooth, 20 scales around the tail (Fig.
Dorsal ground colouration of body, head and tail dark bronze-brown; head with scattered dark markings; dorsal scales of body and tail finely outlined by dark brown, centre of scales with black markings forming indistinct stripes, tail dark; limbs almost black, with light spots; a thick black stripe running from rostrum through orbit and onto flank and tail with scattered light spots bordered dorsally by a broken white stripe; supralabials with a white streak; ventral regions glossy white with numerous dark reticulations.
Mensural and meristic data for the paratype series are given in Table
Mensural (mm) and meristic data for Dravidoseps tamilnaduensis sp. nov. and Dravidoseps sp. Abbreviations are listed in Materials and Methods except for: L&R = Left & Right; M = male; F = female; Sa = Subadult; * = data incomplete; and / = data unavailable.
Museum number | NRC-AA- 8286 | NRC-AA- 8287 | NRC-AA- 8288 | BNHS 2857 | BNHS 2858 | BNHS 2859 | BNHS 2860 | ZSI-R- 28621 | ZSI-R- 28691 | ZSI-R- 28692 | ZSI-R- 28693 | ZSI-R- 28695 | NRC-AA-8289 |
Type | Holotype | Paratypes | Dravidoseps sp. | ||||||||||
Sex | F | M | F | F | Sa | F | Sa | M | Sa | M | M | F | Sa |
SVL | 48.5 | 45.3 | 55.2 | 49.9 | 25.6 | 45.7 | 24.9 | 53.5 | 37 | 42.4 | 50.6 | 43.1 | 32.4 |
TL | 43.0 | 34.3 | 35.7 | 6.5* | 26.0 | 33.9* | 25.8 | 53.8 | 29.0* | 24.3 | 12.9* | 10.8* | 31.1 |
TW | 4.1 | 3.5 | 4.2 | 3.6 | 1.9 | 4.0 | 2.2 | 4.1 | 2.3 | 3.8 | 4.4 | 3.4 | 2.6 |
FL | 3 | 3.0 | 3.2 | 3.0 | 1.6 | 3.0 | 1.7 | 3.1 | 2.4 | 2.9 | 3.3 | 3 | 2* |
CL | 4.0 | 3.9 | 4.3 | 3.9 | 2.2 | 3.9 | 2.4 | 4.2 | 2.7* | 4.0 | 4.4 | 4.0 | 2.6 |
AGL | 28.9 | 25.5 | 32.4 | 29.9 | 12.9 | 27.7 | 11.6 | 33.3 | 19.9 | 26.1 | 29.3 | 26.0 | 17.8 |
BH | 4.0 | 3.5 | 4.1 | 4.1 | 2.1 | 5.3 | 2.4 | 5.0 | 3.0 | 3.3 | 4.1 | 3.9 | 3.6 |
BW | 6.8 | 7.3 | 8.6 | 7.8 | 3.9 | 8.1 | 4.0 | 8.2 | 4.5 | 6.2 | 7.6 | 7.2 | 4.6 |
HL | 8.3 | 7.8 | 8.5 | 8.7 | 5.7 | 7.3 | 5.7 | 8.3 | 6.6 | 7.3 | 8.4 | 7.7 | 5.3 |
HW | 5.0 | 5.0 | 5.7 | 5.6 | 3.9 | 5.0 | 3.7 | 5.6 | 4.0 | 5.4 | 5.4 | 5.3 | 4.1 |
HH | 4.1 | 3.3 | 4.1 | 3.7 | 2.6 | 3.7 | 2.7 | 4.4 | 2.8 | 4.1 | 4.0 | 3.4 | 3.3 |
ED | 1.7 | 1.7 | 1.6 | 1.6 | 1.2 | 1.6 | 1.2 | 1.6 | 1.4 | 1.6 | 1.8 | 1.7 | 1.4 |
TWD | 0.8 | 0.9 | 0.9 | 0.8 | 0.5 | 0.7 | 0.6 | 0.8 | 0.7 | 0.9 | 0.9 | 0.8 | 0.6 |
EE | 3.3 | 2.9 | 3.3 | 3.2 | 2.1 | 3.1 | 2.2 | 3.3 | 2.5 | 3.1 | 3.3 | 2.7 | 2.4 |
EL | 0.6 | 0.8 | 0.8 | 0.7 | 0.3 | 0.5 | 0.4 | 0.5 | 0.5 | 0.7 | 0.7 | 0.6 | 0.4 |
ES | 3.4 | 3.0 | 3.5 | 3.4 | 2.1 | 3.3 | 2.3 | 3.6 | 2.6 | 3.0 | 3.4 | 3.0 | 2.3 |
EN | 2.2 | 2.0 | 2.2 | 2.0 | 1.3 | 2.2 | 1.4 | 2.3 | 1.5 | 2.0 | 2.2 | 2.0 | 1.4 |
IN | 1.4 | 1.3 | 1.6 | 1.5 | 1.1 | 1.4 | 1.1 | 1.3 | 1.2 | 1.4 | 1.4 | 1.4 | 1.2 |
IO | 3.0 | 2.8 | 3.3 | 3.5 | 2.2 | 2.9 | 2.2 | 3.5 | 2.4 | 2.8 | 2.9 | 2.7 | 2.3 |
Nu | 1&1 | 1&1 | 2&2 | 1&1 | 2&2 | 2&2 | 2&1 | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 1&1 |
Sb Nu | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 |
SL L&R | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 | 7&7 |
IL L&R | 6&6 | 6&6 | 6&6 | 7&7 | 6&6 | 6&6 | 6&6 | 7&6 | 6&6 | 6&6 | 6&6 | 6&6 | 6&6 |
PoSL L&R | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 |
Elo L&R | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 2&2 | 1&2 | 2&2 | 2&2 | 2&2 |
PVS | 67 | 67 | 69 | 66 | 67 | 69 | 67 | 70 | 70 | 69 | 66 | 69 | 64 |
RBS | 29 | 30 | 30 | 30 | 30 | 28 | 30 | 30 | 28 | 30 | 30 | 30 | 28 |
VS | 65 | 65 | 71 | 69 | 66 | 68 | 66 | 69 | 64 | 68 | 71 | 70 | / |
SPCLR | 10 | 10 | 10 | 10 | / | 10 | / | 10 | 10 | 10 | 10 | 10 | 10 |
RTS | 20 | 21 | 21 | 21 | 21 | 21 | / | 21 | 20 | 21 | 21 | 21 | 21 |
LamF1 L&R | 5&5 | 5&5 | 5&5 | 5&5 | 5&5 | 5&5 | 5&5 | 5&6 | 6&5 | 6&6 | 6&6 | 5&5 | 6&5 |
LamF4 L&R | 10&10 | 10&11 | 6*&11 | 9&10 | 10&10 | 9&9 | 10&10 | 11&11 | 10&11 | 10&11 | 11&11 | 11&11 | 10&10 |
LamT1 L&R | 5&5 | 5&6 | 5&5 | 5&5 | 5&5 | 5&5 | 5&5 | 5&6 | 6&6 | 6&6 | 6&7 | 5&5 | 6&6 |
LamT4 L&R | 14&14 | 14&14 | 13&15 | 12&13 | 13&14 | 12&13 | 13&13 | 14&14 | 14&15 | 15&15 | 15&16 | 15&5* | 13&13 |
Elongate supralabial below eye, fourth (1) or fifth (0) L&R | 0&0 | 0&0 | 0&0 | 0&0 | 0&0 | 0&0 | 0&0 | 0&0 | 0&0 | 0&0 | 0&0 | 0&0 | 0&0 |
Dravidoseps tamilnaduensis sp. nov. is known from three broad localities in the broader Shevaroyan landscape, from Pachaimalai Hills in Tiruchirappalli District (type locality), Kolli Hills in Namakkal District, and southern slopes of Yercaud in Salem District, Tamil Nadu India, between elevations of 400–850 m asl. (Fig.
At the type locality, Dravidoseps tamilnaduensis sp. nov. was observed in high abundance (n = >15 hr) in a semi-evergreen forest patch with more or less closed canopy and heavy leaf-litter on the forest floor (Fig.
Viviparous, litter size two (n = 1). BNHS 2859 with two almost completely developed embryos (Fig.
Mensural and meristic data of a single unsexed adult specimen (ZSI/SRS/VRL 470; from Pachaimalai) given in
1. | Scales on tail base not keeled | 2 |
– | Scales on tail base keeled | D. goaensis |
2. | Two postsupralabials on each side | 3 |
– | One postsupralabial on each side | D. pruthi |
3. | ≥ 12 scales on precloacal row | 4 |
– | ≤ 10 scales on precloacal row | 5 |
4. | Five post-suboculars, one or two nuchals on each side and no scales between nuchals, 22 or 23 scales around the tail | D. jawadhuensis |
– | Three or four post-suboculars, one nuchal on each side and three scales between nuchals, 21 scales around the tail | D. gingeeensis |
5. | 3–6 (mean > 3.9) total ear lobules | 6 |
– | 2–4 (mean < 2.3) total ear lobules | 7 |
6. | 10 (mean 10.0) scales on precloacal row, 28–30 (mean 29.6) scales around the body, 66–70 (mean 68.0) paravertebral scales | D. tamilnaduensis |
– | 8–10 (mean 9.2) scales on precloacal row, 26–29 (mean 27.8) scales around the body, 63–66 (mean 64.5) paravertebral scales | D. srivilliputhurensis |
7. | 8 (mean 8.0) scales on precloacal row, 18–19 (18.7) scales around the tail, usually 6 supralabials | D. kalakadensis |
8–10 (mean 9.2) scales on precloacal row, 19–22 (20.1) scales around the tail, 7 supralabials | D. nilgiriensis |
This is the first fine-scale phylogeographic work on a radiation of Indian skinks, resulting in the recognition of a new genus and the description of five new species, including the first micro-endemic peninsular Indian skinks outside of the Western Ghats (
The recognition of Dravidoseps meets all the priority taxon naming criteria outlined by
With five species and an additional unnamed, genetically divergent lineage, the greater Shevaroyan landscape appears to be the hotspot of Dravidoseps species diversity. This sky-island landscape includes several massifs that rise above 1000 m asl. and the smaller Gingee Hills (< 500 m asl.), all of which are separated by warmer lowlands with markedly more open vegetation. A number of geckos are endemic to massifs in this landscape including seven species of the Cnemaspis gracilis (Beddome) clade (
The center of diversity of the Lygosomini is India and Southeast Asia, with three subclades distributed in each region, and the ancestral area of its MRCA reconstructed as distributed in Southeast Asia (Fig.
The first indications of seasonality in India date back to the late Eocene (40 Mya;
Species of Dravidoseps live in cooler, more seasonal and climatically extreme habitats with lower canopy cover and rainfall than Subdoluseps sensu stricto in Southeast Asia (Fig.
The role of lowland habitats in preventing historical gene flow within Dravidoseps is most pronounced in the massifs outside the Western Ghats, where the lowlands are warmer and more open with scrubby or grassland vegetation, with high diversity in the landscape and each species restricted to a single massif or a few closely grouped massifs. A few species of Dravidoseps have been able to recently disperse across lowland habitats separating hill ranges or massifs while some Western Ghats species are distributed relatively widely across contiguous forest habitat (Fig.
Dravidoseps is another non-adaptive radiation of skinks that exhibit a decoupling between speciation and phenotypic divergence (e.g.
The evolution of viviparity in squamates is strongly associated with cool temperatures, but the highest number of viviparous species are in the tropics (Feldman et al. 2015;
Live-birth has originated >12 times within skinks with over 30 % of species being viviparous (
The presence or absence of a transparent window in the lower eyelid has been an important character used in higher level skink taxonomy (e.g.
We presented genetic, morphological and ecological data to recognize a new genus of lygosomine skink endemic to peninsular India and five new species. Members of Dravidoseps are forest-obligate and highly conserved in morphology, making species diagnoses challenging. The Lygosomini began diversifying in the Eocene and may have had an Indian or Southeast Asian origin. Diversification within Dravidoseps was likely driven by paleoclimate and the distribution of forests, with a similar timeline seen in Subdoluseps sensu stricto, Mochlus, Lygosoma and Riopa. Dravidoseps evolved at a time of global cooling and increasing seasonality, and today inhabit cooler, drier and more seasonal habitats than Subdoluseps sensu stricto which are oviparous – any or all of which may have contributed to the evolution of viviparity within the group.
We thank the Tamil Nadu Forest Department for permits to carry out this study (permit no. 53/2018). We thank Teja Bhargava (former DFO, Jawadhu) for his help and co-ordination throughout fieldwork. Fieldwork assistance was provided by Swapnil Pawar, Vaibhav Patil, Satpal Gangalmale, Vivek Waghe, and Satheesh Kumar. Satpal Gangalmale and Vivek Waghe helped with preliminary data collection from specimens. Tarun Karmakar (NCBS field station and museum facility, Bengaluru), Pratyush Mohapatra (ZSIK) and Rahul Khot and Saunak Pal (BNHS) helped with specimen registration. We are thankful to Uma Ramakrishnan for lab support at NCBS, Aniruddha Datta-Roy for providing the holotype of Dravidoseps jawadhuensis, and Navendu Page for habitat photographs of Jawadhu Hills. We thank Elyse Freitas for sharing data on Myanmar lygosomines, Aaron M Bauer and R Chaitanya for comments on the draft manuscript, SR Ganesh for sharing sighting data of Dravidoseps. At the Field Museum, we thank Rachunliu Kamei and Joshua Mata for their help providing photographs of skulls; Stephanie Ware, Manager Morphology Labs for photography and the Collaborative Invertebrate Laboratories and Margaret Thayer for use of imaging equipment (funded by NSF grant EF-0531768/subcontract 144-439, the Grainger Foundation and The Field Museum). We thank Deepak Deshpande, Adwait Aphale and Vinayak A Mane for their help with X-rays and ultrasonography. We thank Shai Meiri, Justin Lee and a third, anonymous reviewer for their valuable input.
Figures S1, S2
Data type: .zip
Explanation notes: Figure S1. Complete chronogram from divergence dating analyses. Bars at nodes show 95% HPD. — Figure S2. Maximum Likelihood phylogeny of Dravidoseps gen. nov. with posterior probability/ bootstrap support shown at nodes: A 16S; B PRLR; C RAG-1; D R35.
Tables S1–S4
Data type: .zip
Explanation notes: Table S1. Sequences used for divergence dating analyses. — Table S2. Best-fit models of sequence evolution and partitioning schemes selected in PartitionFinder2 for different datasets. — Table S3. Indian Dravidoseps and southeast Asian Subdoluseps localities used in climate analyses. — Table S4. Diagnostic differences in nuclear sequences within Dravidoseps.