Research Article |
|
Corresponding author: Justin L. Lee ( justinllee@verizon.net ) Corresponding author: Nikolay A. Poyarkov Jr. ( n.poyarkov@gmail.com ) Academic editor: Uwe Fritz
© 2023 Platon V. Yushchenko, Justin L. Lee, Hieu Minh Pham, Peter Geissler, Elena V. Syromyatnikova, Nikolay A. Poyarkov Jr..
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Yushchenko PV, Lee JL, Pham HM, Geissler P, Syromyatnikova EV, Poyarkov Jr. NA (2023) The taxonomic status of the kukri snake Oligodon arenarius Vassilieva, 2015 with a redescription of Oligodon macrurus (Angel, 1927) (Squamata, Serpentes, Colubridae). Vertebrate Zoology 73: 97-125. https://doi.org/10.3897/vz.73.e96958
|
We investigated the taxonomic status of the recently described kukri snake Oligodon arenarius Vassilieva, 2015 and the morphologically similar Oligodon macrurus (Angel, 1927), two species endemic to the southern coast of Vietnam. Based on phylogenetic analyses using three mitochondrial genes (12S–16S rRNA, cytochrome b), we recovered O. arenarius and O. macrurus in a clade within the O. cyclurus-taeniatus species group, agreeing with previous intrageneric classifications. Genetic distances between O. arenarius and O. macrurus are extremely low (less than 0.5% based on 12S–16S) and render O. arenarius paraphyletic. All preserved specimens of O. arenarius and O. macrurus convey little to no differences in color pattern, hemipenial morphology and osteological features; the latter of which is based on three dimensional micro computer tomography (µCT) scans of one specimen per species. Contrasting these results, univariate and multivariate analyses revealed significant differences in relative tail length, and the number of ventral and subcaudal scales between both species. Although the molecular and morphological datasets present conflicting results, integrating the evidence leads us to synonymize O. arenarius with O. macrurus. We provide a formal redescription of O. macrurus, designate a neotype specimen to avoid future taxonomic confusion, and provide the first detailed osteological description of this species. Oligodon macrurus sensu stricto is endemic to coastal dunefields and adjacent forest habitats in southern Vietnam, where ongoing human development, tourism and road mortality pose significant threats to its conservation. Consequently, we suggest that O. macrurus should be listed as “Vulnerable” based on the assessment criteria of the International Union for Conservation of Nature (IUCN).
Biodiversity, conservation, hemipenis, molecular phylogenetics, morphology, Reptilia, Vietnam
The kukri snakes of the genus Oligodon Fitzinger, 1826 are a species-rich group of colubrids comprised of 89 recognized species (
The first species, O. macrurus, was described as Simotes violaceus macrurus based on a single specimen collected in 1925 by M. Pierre Chevey from “Pointe Lagan”, now the sand dunes surrounding Mui La Gan, Binh Thuan Province, Vietnam. The type specimen was deposited in the Museum Nationale d’Histoire Naturelle, Paris (MNHN), but according to
Over the past decade, some of us (PVY, NAP, HMP, PG) have collected additional kukri snake specimens from the dunefields of southern Vietnam that putatively resemble the original descriptions of O. macrurus and O. arenarius. Neither species has been sampled in a molecular phylogenetic assessment, and the descriptions of the O. arenarius hemipenes from
This contribution is based on a study of 20 specimens of O. arenarius (n = 9) and O. macrurus (n = 11), including available museum specimens and new material collected by us. Data from an additional O. arenarius and four O. macrurus (including the lost holotype) originate from literature sources (
Known distribution of Oligodon arenarius (light blue) and O. macrurus (blue) in Vietnam. Stars denotes type locality. Localities: 1 Ho Chi Minh City; 2 Binh Chau–Phuoc Buu Nature Reserve, Ba Ria–Vung Tau Prov. (type locality of O. arenarius); 3 near Phan Thiet city, Binh Thuan Province; 4 Mui Ne, Binh Thuan Province; 5 Mui La Gan, Binh Thuan Province (type locality of O. macrurus); 6 Nui Chua National Park, Ninh Thuan Province; 7 Nha Trang, Khanh Hoa Province; 8 Hon Tre Island, Khanh Hoa Province.
For all aspects of species concepts and delimitation, we follow the General Lineage Concept (
Total genomic DNA was extracted from muscle tissue samples preserved in 95% ethanol using a Qiagen DNAeasy Blood and Tissue Kit following manufacture protocols. We performed polymerase chain reactions (PCRs) to amplify two fragments of mitochondrial DNA (mtDNA): the first fragment including partial sequences of 12S ribosomal RNA (rRNA), transfer RNA (tRNA)–Valine and 16S rRNA genes (total length 1942 bp), and the second fragment including complete sequences of the cytochrome b (cyt b) gene (1091 bp). Primers used for both PCRs and sequencing are summarized in Table
| Gene | Primer name | Sequence (5’–3’) | Reference |
| 12S–16S | Oligo12S2LM | ACACACCGCCCGTCACCCT |
|
| 12S–16S | Oligo16S5H | CTACCTTTGCACGGTTAGGATACCGCGGC |
|
| 16S | Oligo16S1LM | CCGACTGTTGACCAAAAACAT |
|
| 16S | 16S–H–1 | CTCCGGTCTGAACTCAGATCACGTAGG |
|
| cytochrome b | H14910 | GACCTGTGATMTGAAAAACCAYCGTT |
|
| cytochrome b | THRSN2 | CTTTGGTTTACAAGAACAATGCTTTA |
|
To examine the position of O. macrurus and O. arenarius in a mtDNA phylogeny of Oligodon, we aligned our newly obtained sequences with other available Oligodon sequences from GenBank (summarized in Table
List of sequences and corresponding voucher specimens of Oligodon and outgroup taxa used in this study. Note that the numbers (column one) included in this table do not match the numbers used in other tables or figures in the text. Acronyms not described in the materials and methods include the following: CHS, unknown field tag series; RAP, field tags of R. Alexander Pyron; RS, field tags of Ruchira Somaweera; NP, national park; NR, nature reserve; WS, wildlife sanctuary.
| No. | Sample ID | Genbank AN | Species | Country | Locality | Reference |
|---|---|---|---|---|---|---|
| 1 | ZMMU Re-13857 | OP752557; OP752571 | Oligodon macrurus | Vietnam | Khanh Hoa Prov., Hon Tre island | this work |
| 2 | ZMMU Re-11561 | OP752565; OP752576 | Oligodon macrurus | Vietnam | Ninh Thuan Prov., Nui Chua NP | this work |
| 3 | ZMMU Re-16807 | OP752561; OP764583 | Oligodon macrurus | Vietnam | Binh Thuan Prov., Phan Thiet | this work |
| 4 | ZMMU Re-16808 | OP752562; OP764584 | Oligodon macrurus | Vietnam | Binh Thuan Prov., Phan Thiet | this work |
| 5 | ZMMU Re-16809 | OP752563; OP764585 | Oligodon macrurus | Vietnam | Binh Thuan Prov., Phan Thiet | this work |
| 6 | ZFMK 88884 | OP764587 | Oligodon macrurus | Vietnam | Binh Thuan Prov., Mui Ne | this work |
| 7 | ZFMK 88885 | OP764588 | Oligodon macrurus | Vietnam | Binh Thuan Prov., Mui Ne | this work |
| 8 | ZMMU Re-14502 | OP752568; OP752573 | Oligodon arenarius | Vietnam | Ba Ria–Vung Tau Prov., Binh Chau–Phuoc Buu NR | this work |
| 9 | ZMMU Re-15136 | OP752569; OP752574 | Oligodon arenarius | Vietnam | Ba Ria–Vung Tau Prov., Binh Chau–Phuoc Buu NR | this work |
| 10 | ZMMU Re-14503 | OP752566; OP752577 | Oligodon arenarius | Vietnam | Ba Ria–Vung Tau Prov., Binh Chau–Phuoc Buu NR | this work |
| 11 | ZMMU Re-14504 | OP752567; OP752572 | Oligodon arenarius | Vietnam | Ba Ria–Vung Tau Prov., Binh Chau–Phuoc Buu NR | this work |
| 12 | VNMN 04724 | OP752570; OP752575 | Oligodon arenarius | Vietnam | Ba Ria–Vung Tau Prov., Binh Chau–Phuoc Buu NR | this work |
| 13 | ZMMU Re-16804 | OP752558; OP764580 | Oligodon arenarius | Vietnam | Ba Ria–Vung Tau Prov., Binh Chau–Phuoc Buu NR | this work |
| 14 | ZMMU Re-16805 | OP752559; OP764581 | Oligodon arenarius | Vietnam | Ba Ria–Vung Tau Prov., Binh Chau–Phuoc Buu NR | this work |
| 15 | ZMMU Re-16806 | OP752560; OP764582 | Oligodon arenarius | Vietnam | Ba Ria–Vung Tau Prov., Binh Chau–Phuoc Buu NR | this work |
| 16 | ZMMU NAP-10091 | OP752564; OP764586 | Oligodon arenarius | Vietnam | Ba Ria–Vung Tau Prov., Binh Chau–Phuoc Buu NR | this work |
| 17 | SIEZC 20201 | MN395604; MN396765 | Oligodon rostralis | Vietnam | Lam Dong Prov., Bidoup–Nui Ba NP |
|
| 18 | ZMMU Re-14304 | MN395601; MN396762 | Oligodon annamensis | Vietnam | Dak Lak Prov., Chu Yang Sin NP |
|
| 19 | CBC 01899 | MN395602; MN396763 | Oligodon annamensis | Cambodia | Pursat Prov., Veal Veng, Samkos WS |
|
| 20 | UMMZ201913 | HM591519 | Oligodon octolineatus | Brunei | Tutong Dist., 3 km E of Tutong |
|
| 21 | ROM 35626 | HM591526 | Oligodon chinensis | Vietnam | Cao Bang Prov., Quang Thanh |
|
| 22 | ROM 30970 | HM591528 | Oligodon chinensis | Vietnam | Nghe An Prov., 24 km W of Con Cuong |
|
| 23 | ROM 34540 | HM591527 | Oligodon chinensis | Vietnam | Hai Duong Prov., Chi Linh |
|
| 24 | ROM 31032 | HM591524 | Oligodon chinensis | Vietnam | Vinh Phuc Prov., Tam Dao NP |
|
| 25 | ROM 30824 | HM591525 | Oligodon chinensis | Vietnam | Tuyen Quang Prov., Pac Ban |
|
| 26 | ROM 30823 | HM591529 | Oligodon formosanus | Vietnam | Tuyen Quang Prov., Pac Ban |
|
| 27 | ROM30826 | HM591530 | Oligodon formosanus | Vietnam | Vinh Phuc Prov., Tam Dao NP |
|
| 28 | ROM30939 | HM591531 | Oligodon formosanus | Vietnam | Cao Bang Prov., Ba Be NP |
|
| 29 | ROM35629 | HM591533 | Oligodon formosanus | Vietnam | Cao Bang Prov., Quang Thanh |
|
| 30 | ROM35806 | HM591532 | Oligodon formosanus | Vietnam | Hai Duong Prov., Chi Linh |
|
| 31 | ROM32261 | HM591534 | Oligodon ocellatus | Vietnam | Dak Lak Prov., Yok Don NP |
|
| 32 | ROM32260 | HM591521 | Oligodon taeniatus | Vietnam | Dak Lak Prov., Yok Don NP |
|
| 33 | ROM37091 | HM591522 | Oligodon taeniatus | Vietnam | Dong Nai Prov., Cat Tien NP |
|
| 34 | ROM32464 | HM591523 | Oligodon barroni | Vietnam | Gai Lai Prov., Krong Pa |
|
| 35 | USNM520625 | HM591520 | Oligodon cf. taeniatus | Myanmar | Chatthin, 2 km WNW Chatthin WS |
|
| 36 | CAS204963 | HM591535 | Oligodon cyclurus | Myanmar | Ayeyarwady Reg., Mwe Hauk |
|
| 37 | CAS215636 | HM591536 | Oligodon cyclurus | Myanmar | Sagaing Reg., Alaungdaw Kathapa NP |
|
| 38 | ROM37092 | HM591504 | Oligodon cinereus | Vietnam | Dong Nai Prov., Cat Tien NP |
|
| 39 | CAS213379 | HM591506 | Oligodon cinereus | Myanmar | Yangon Reg., Hlaw Ga NP |
|
| 40 | CAS205028 | HM591507 | Oligodon cinereus | Myanmar | Rakhine St., Rakhine Yoma Mts. |
|
| 41 | ROM32462 | HM591501 | Oligodon cinereus | Vietnam | Hai Duong Prov., Chi Linh |
|
| 42 | ROM29552 | HM591502 | Oligodon cinereus | Vietnam | Vinh Phuc Prov., Tam Dao NP |
|
| 43 | ROM30969 | HM591503 | Oligodon cinereus | Vietnam | Nghe An Prov., 24 km W of Con Cuong |
|
| 44 | CAS215261 | HM591508 | Oligodon cinereus | Myanmar | Shan St., Kalaw |
|
| 45 | CAS204855 | HM591509 | Oligodon splendidus | Myanmar | Mandalay Reg., Kyauk Se |
|
| 46 | USNM520626 | HM591510 | Oligodon splendidus | Myanmar | Chatthin, 2 km WNW Chatthin WS |
|
| 47 | CAS210693 | HM591512 | Oligodon torquatus | Myanmar | Magwe Reg., Pakokku |
|
| 48 | CAS215976 | HM591513 | Oligodon torquatus | Myanmar | Mandalay Reg., Min Gone Taung WS |
|
| 49 | CAS213822 | HM591514 | Oligodon planiceps | Myanmar | Magwe Reg., Shwe Set Taw WS |
|
| 50 | CAS210710 | HM591515 | Oligodon theobaldi | Myanmar | Mandalay Reg., Naung U |
|
| 51 | CAS213896 | HM591516 | Oligodon theobaldi | Myanmar | Magwe Reg., Shwe Set Taw WS |
|
| 52 | CAS213271 | HM591517 | Oligodon cruentatus | Myanmar | Yangon Reg., Hlaw Ga NP |
|
| 53 | ROM27049 | HM591518 | Oligodon eberhardti | Vietnam | Cao Bang Prov., Quang Thanh |
|
| 54 | TNHC59846 | HM591511 | Oligodon maculatus | Philippines | Mindanao, Barangay Baracatan |
|
| 55 | RS-OC | KC347328; KC347366 | Oligodon calamarius | Sri Lanka | Kandy Dist. |
|
| 56 | RAP 504 | KC347329; KC347367 | Oligodon sublineatus | Sri Lanka | Kandy Dist. |
|
| 57 | RAP 483 | KC347327; KC347365 | Oligodon arnensis | Sri Lanka | Hambantota Dist. |
|
| 58 | RS 136 | KC347330; KC347368 | Oligodon taeniolatus | Sri Lanka | Polonnaruwa Dist. |
|
| 59 | CHS 683 | MK194147; MK065575 | Oligodon ornatus | China | — | Li et al. (Unpublished) |
| 60 | SYNU 1808001 | MW489823 | Oligodon bivirgatus | China | Hainan |
|
| 61 | CHS 703 | MK194159; MK201481 | Oligodon catenatus | China | — | Li et al. (Unpublished) |
| 62 | CHS 187 | MK193967; MK201318 | Oligodon lacroixi | China | — | Li et al. (Unpublished) |
| 63 | CHS 850 | MK194265; MK201568 | Oligodon albocinctus | China | — | Li et al. (Unpublished) |
| Outgroups | ||||||
| 64 | — | KP684155 | Hebius vibakari | — | — | — |
| 65 | — | GQ181130 | Oreocryptophis porphyraceus | — | — | — |
We included all examined O. arenarius (n = 9) and O. macrurus (n = 11), along with literature data from four specimens in our morphological dataset (n = 24). In all examined specimens, sex was determined by a ventral insertion near the tail base to detect the presence or absence of hemipenes. Color characters and patterns were recorded during examination of specimens in preservation. For some specimens these data were taken from digital images that depicted their coloration in life. Morphological characters and morphometric ratios considered to be of taxonomic importance in Oligodon were used for species descriptions and followed a number of recent taxonomic treatments (
The micro Computer Tomograph (µCT) scans of O. arenarius and O. macrurus were performed at the Paleontological Institute of the Russian Academy of Sciences (RAS) using a SkyScan 1172 Computer Tomography scanner (Bruker micro-CT, Kontich, Belgium). Scans were generated from one adult specimen of O. arenarius (ZMMU Re-14502, paratype) and one adult specimen of O. macrurus (ZMMU Re-13857), both males. The heads of each specimen were scanned for 150 minutes at a voxel size of 5.3 μm and recorded data at every 0.2° rotation for 180° with an Aluminum 1.0 mm filter. The source voltage for the scan was 60 kV and the source current was 165 μA. For each specimen, a total of 1021 transmission images were reconstructed into a 1160 × 1160 matrix of 1000 TIFF slices using Nrecon 1.6.10.4 reconstruction software. Volume rendering and further processing was performed using Avizo 8.1. Cranial osteological descriptions were based on three dimensional (3D) volume renders of each specimen retrieved from Avizo. Terminology used in osteological descriptions are adapted from
The following linear measurements taken (all in mm), along with acronyms for morphological characters used in Tables
For statistical analyses, we made adaptations to a workflow popularized by
The final concatenated alignment of 12S rRNA–16S rRNA and cyt b gene sequences contained 3033 base pairs, of which, 1889 sites were conserved and 1109 sites were variable, of which 782 were found to be parsimony informative. The transition-transversion bias for (I) was estimated as 2.31. Nucleotide frequencies were 37.2% (A), 22.4% (T), 25.3% (C), and 15.0% (G) (all data given for ingroups only). Our mtDNA-based genealogy for the genus Oligodon (Fig.
Bayesian inference tree of Oligodon derived from the analysis of 3,019 bp of 12S rRNA–16S rRNA and cyt b mitochondrial DNA gene sequences. For voucher specimen information and GenBank accession numbers see Table
The uncorrected p-distances for the 16S rRNA gene fragment among and within examined Oligodon species are presented in Table
Genetic differentiation of Oligodon. Uncorrected p-distances (given as percentages) between sequences of 12S–16S rRNA (below diagonal) and intraspecific genetic p-distances of Oligodon species (on diagonal) included in phylogenetic analyses.
| No. | Species | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | 20 | 21 | 22 | 23 | 24 | 25 | 26 | 27 | 28 |
| 1 | O. macrurus | 0.6 | |||||||||||||||||||||||||||
| 2 | O. arenarius | 0.5 | 0.4 | ||||||||||||||||||||||||||
| 3 | O. annamensis | 5.2 | 4.9 | 1.0 | |||||||||||||||||||||||||
| 4 | O. rostralis | 6.1 | 5.6 | 4.1 | — | ||||||||||||||||||||||||
| 5 | O. arnensis | 6.2 | 5.9 | 5.5 | 6.1 | — | |||||||||||||||||||||||
| 6 | O. calamarius | 7.0 | 6.5 | 6.3 | 6.6 | 6.6 | — | ||||||||||||||||||||||
| 7 | O. sublineatus | 7.7 | 7.2 | 6.4 | 7.3 | 5.9 | 3.1 | — | |||||||||||||||||||||
| 8 | O. taeniolatus | 6.7 | 6.3 | 7.1 | 6.9 | 5.4 | 3.8 | 3.3 | — | ||||||||||||||||||||
| 9 | O. octolineatus | 6.8 | 6.5 | 5.0 | 4.5 | 7.9 | 6.9 | 7.9 | 8.3 | — | |||||||||||||||||||
| 10 | O. chinensis | 6.3 | 6.1 | 5.5 | 4.9 | 5.6 | 6.5 | 7.2 | 7.0 | 7.1 | 0.8 | ||||||||||||||||||
| 11 | O. ornatus | 6.8 | 6.6 | 5.3 | 6.9 | 5.7 | 4.7 | 5.0 | 5.2 | 7.9 | 6.3 | — | |||||||||||||||||
| 12 | O. cinereus | 7.8 | 7.4 | 7.1 | 8.1 | 7.1 | 6.3 | 6.6 | 6.1 | 8.7 | 7.5 | 6.9 | 3.7 | ||||||||||||||||
| 13 | O. eberhardti | 8.4 | 8.1 | 6.9 | 7.9 | 6.9 | 6.9 | 6.7 | 7.2 | 8.7 | 7.4 | 5.5 | 6.9 | — | |||||||||||||||
| 14 | O. bivirgatus | 8.0 | 7.8 | 5.5 | 7.3 | 6.1 | 5.4 | 5.2 | 5.4 | 8.6 | 7.3 | 2.4 | 6.5 | 6.0 | — | ||||||||||||||
| 15 | O. albocinctus | 7.4 | 7.0 | 6.0 | 5.9 | 6.1 | 5.4 | 5.4 | 5.7 | 6.2 | 6.3 | 6.9 | 5.5 | 7.4 | 6.1 | — | |||||||||||||
| 16 | O. lacroixi | 6.0 | 5.6 | 5.0 | 5.7 | 5.0 | 4.5 | 5.7 | 5.0 | 6.4 | 6.1 | 3.5 | 5.9 | 4.3 | 3.8 | 5.2 | — | ||||||||||||
| 17 | O. catenatus | 7.1 | 6.8 | 5.2 | 6.1 | 5.2 | 5.9 | 5.7 | 6.1 | 7.4 | 6.1 | 4.3 | 6.3 | 2.2 | 4.7 | 6.6 | 3.1 | — | |||||||||||
| 18 | O. formosanus | 5.5 | 5.3 | 4.7 | 4.3 | 4.9 | 5.7 | 6.4 | 6.2 | 6.0 | 1.7 | 5.5 | 7.3 | 7.3 | 6.7 | 6.1 | 5.2 | 5.5 | 0.6 | ||||||||||
| 19 | O. ocellatus | 6.3 | 6.1 | 4.6 | 4.5 | 5.9 | 6.6 | 7.1 | 7.1 | 6.0 | 3.7 | 6.1 | 6.9 | 7.9 | 5.9 | 5.7 | 5.0 | 6.1 | 3.3 | — | |||||||||
| 20 | O. taeniatus | 4.8 | 4.6 | 4.5 | 4.6 | 6.1 | 6.3 | 7.2 | 6.8 | 6.3 | 3.9 | 5.8 | 7.4 | 7.8 | 7.0 | 6.8 | 5.6 | 6.3 | 3.6 | 3.9 | 0.2 | ||||||||
| 21 | O. barroni | 5.1 | 5.0 | 5.8 | 5.7 | 7.3 | 7.3 | 8.3 | 8.0 | 6.9 | 4.9 | 7.1 | 8.5 | 9.1 | 8.3 | 7.3 | 6.4 | 7.6 | 4.6 | 5.0 | 2.8 | — | |||||||
| 22 | O. cyclurus | 6.6 | 6.5 | 5.4 | 6.0 | 6.9 | 6.5 | 7.3 | 7.2 | 7.5 | 5.7 | 6.4 | 7.0 | 8.1 | 6.9 | 6.6 | 6.0 | 6.6 | 5.4 | 4.0 | 3.4 | 5.1 | 3.1 | ||||||
| 23 | O. splendidus | 7.2 | 6.8 | 7.2 | 7.3 | 7.2 | 5.2 | 5.4 | 5.0 | 8.3 | 6.2 | 6.6 | 4.7 | 7.4 | 6.4 | 4.5 | 5.9 | 6.9 | 6.5 | 6.4 | 6.5 | 7.6 | 6.7 | 0.5 | |||||
| 24 | O. torquatus | 8.3 | 8.0 | 8.3 | 9.9 | 8.4 | 8.4 | 8.6 | 8.3 | 11.1 | 10.0 | 8.6 | 7.4 | 9.7 | 9.1 | 9.7 | 8.6 | 8.4 | 9.2 | 9.7 | 7.8 | 9.1 | 8.6 | 7.6 | 1.4 | ||||
| 25 | O. planiceps | 7.4 | 7.1 | 7.2 | 7.8 | 7.3 | 5.9 | 7.1 | 6.2 | 9.3 | 7.8 | 7.3 | 6.3 | 8.9 | 7.8 | 7.1 | 6.9 | 7.6 | 6.9 | 7.3 | 7.1 | 8.3 | 7.7 | 5.9 | 5.1 | — | |||
| 26 | O. theobaldi | 7.0 | 6.6 | 7.5 | 8.5 | 7.3 | 6.9 | 7.6 | 5.9 | 9.3 | 8.7 | 7.3 | 6.1 | 8.6 | 7.8 | 7.8 | 6.6 | 7.3 | 7.9 | 8.3 | 6.5 | 8.0 | 7.5 | 6.1 | 2.5 | 4.3 | 0.0 | ||
| 27 | O. cruentatus | 7.7 | 7.3 | 8.2 | 9.2 | 8.0 | 7.6 | 8.3 | 6.6 | 10.0 | 9.4 | 8.0 | 6.8 | 9.3 | 8.5 | 8.5 | 7.3 | 8.0 | 8.7 | 9.0 | 7.2 | 8.7 | 7.9 | 6.9 | 3.2 | 5.0 | 0.7 | — | |
| 28 | O. maculatus | 7.5 | 7.3 | 7.1 | 8.3 | 6.1 | 5.7 | 5.2 | 4.7 | 9.3 | 6.5 | 5.7 | 5.2 | 5.5 | 5.7 | 5.4 | 5.9 | 5.9 | 6.3 | 6.9 | 7.0 | 8.3 | 7.5 | 3.8 | 8.0 | 6.6 | 6.6 | 7.3 | — |
Four characters (VEN, SC, TOTAL, SCR) exhibited normal distributions in all datasets. Relative tail length (TAILR) was the only normally distributed character in the male and female datasets. All characters were heteroscedastic, except for VEN, which exhibited a non-heteroscedastic distribution in the male and combined datasets. Univariate analyses for both male, female and combined datasets showed significant differentiation in the number of body scales and relative tail length between O. arenarius and O. macrurus (Table
Resulting P-values from univariate morphological analyses of sexual dimorphism in Oligodon arenarius and Oligodon macrurus specimens. Characters in bold are considered statistically significant. Cells denoted with a “—” symbol were not examined. All characters were examined using Mann–Whitney U Tests. Abbreviations include “n” standing for number of specimens; “(m)” standing for males, and “(f)” standing for females.
| Character | Oligodon arenarius | Oligodon macrurus | Combined (both species) |
| n | 6 (m) 3 (f) | 9 (m) 6 (f) | 15 (m) 9 (f) |
| TailLR | 0.023810 | 0.000400 | 1.53E-06 |
| MSR | — | 0.447500 | 0.350200 |
| VEN | 0.026880 | 0.000799 | 0.002337 |
| SC | 0.026880 | 0.001723 | 0.000063 |
| TOTAL | 0.027530 | 0.001598 | 0.083700 |
| SCR | 0.023810 | 0.000400 | 1.53E-06 |
| SL | 0.637400 | 0.313400 | 0.236100 |
| SLE | 0.637400 | 0.286400 | 0.222500 |
| IL | 0.637400 | 0.735700 | 0.519500 |
| ILCS | 0.776200 | 0.539200 | 0.857500 |
| PtO | — | 0.819500 | 0.678800 |
| PT | — | 0.496200 | 0.491100 |
Resulting P-values from univariate morphological analyses comparing Oligodon arenarius and Oligodon macrurus specimens. Characters in bold are considered statistically significant. Cells denoted with a “/” symbol were not examined. All characters were examined using Mann–Whitney U Tests, except for those denoted with an asterisk, which were performed using Student’s T-Tests. Abbreviations include “n” standing for number of specimens; “(ar)” standing for O. arenarius, and “(ma)” standing for O. macrurus.
| Character | Males | Females | Pooled (Both sexes) |
| n | 6 (ar) 9 (ma) | 3 (ar) 6 (ma) | 9 (ar) 15 (ma) |
| TailLR | 1.38E-06* | 0.010790* | 0.083780 |
| MSR | 0.496200 | 0.373000 | 0.177200 |
| VEN | 0.002607 | 0.000723* | 0.001270* |
| SC | 7.02E-07* | 0.001027* | 0.006939* |
| TOTAL | 4.71E-06* | 0.000014* | 1.25E-07* |
| SCR | 7.77E-08* | 0.057290* | 0.106900* |
| SL | 0.477300 | 0.637400 | 0.380100 |
| SLE | 0.437300 | 0.637400 | 0.325200 |
| IL | 0.865200 | 0.637400 | 0.645500 |
| ILCS | 0.590600 | 0.721600 | 0.857500 |
| PtO | 0.273200 | — | 0.107400 |
| PT | 0.496200 | — | 0.491100 |
Summary of PC scores and statistics for the Principal Components Analysis (PCA) consisting of Oligodon arenarius and Oligodon macrurus specimens. Abbreviations are listed in the materials and methods. Cells denoted with a “—” symbol were unavailable or not examined.
| Dataset | Both Sexes | Males | Females | ||||||
| Character | PC1 | PC2 | PC3 | PC1 | PC2 | PC3 | PC1 | PC2 | PC3 |
| Standard deviation | 2.023249 | 1.558242 | 1.295387 | 2.216595 | 1.657350 | 1.181847 | 2.005975 | 1.984818 | 1.225493 |
| Proportion of Variance | 0.341130 | 0.202340 | 0.139840 | 0.409440 | 0.228900 | 0.116400 | 0.365810 | 0.358140 | 0.136530 |
| Cumulative Proportion | 0.341130 | 0.543470 | 0.683310 | 0.409440 | 0.638340 | 0.754740 | 0.365810 | 0.723950 | 0.860480 |
| Eigenvalues | 4.093536 | 2.428118 | 1.678028 | 4.913293 | 2.746809 | 1.396762 | 4.023936 | 3.939504 | 1.501833 |
| TailLR | –0.447052 | 0.249969 | 0.093015 | 0.411575 | 0.080445 | –0.030511 | 0.397780 | 0.281640 | –0.097666 |
| MSR | 0.079393 | 0.451285 | 0.033150 | –0.049786 | 0.399299 | –0.488503 | 0.310159 | –0.298034 | –0.400251 |
| VEN | 0.121912 | –0.218162 | –0.658141 | 0.392885 | 0.137416 | 0.125126 | –0.108163 | 0.466711 | –0.090903 |
| SC | –0.464651 | 0.195618 | –0.067444 | 0.441817 | 0.061523 | 0.033930 | 0.244822 | 0.422401 | –0.041109 |
| TOTAL | –0.371280 | 0.051907 | –0.458409 | 0.442466 | 0.092669 | 0.062183 | 0.021248 | 0.496294 | –0.080813 |
| SCR | –0.453981 | 0.232653 | 0.094943 | 0.427830 | 0.031792 | 0.007443 | 0.374383 | 0.239351 | 0.005688 |
| SL | 0.265283 | 0.414914 | –0.134708 | –0.094948 | 0.483870 | 0.244680 | 0.424064 | –0.215350 | 0.195111 |
| SLE | 0.282019 | 0.464760 | –0.157841 | –0.098610 | 0.552936 | 0.030383 | 0.424064 | –0.215350 | 0.195111 |
| IL | 0.174564 | 0.223896 | –0.251328 | –0.023924 | 0.327676 | –0.458959 | –0.013762 | –0.178912 | –0.724594 |
| ILCS | –0.123575 | –0.205080 | –0.171953 | 0.193702 | –0.111878 | –0.573417 | –0.376499 | 0.019319 | –0.169292 |
| PtO | 0.126148 | 0.251417 | 0.251800 | –0.168949 | 0.286459 | 0.131426 | –0.178102 | –0.082965 | 0.428848 |
| PT | –0.086975 | 0.218224 | –0.366335 | 0.119898 | 0.244964 | 0.349555 | — | — | — |
Besides body scalation, two other morphological traits are considered distinct in O. arenarius and O. macrurus, specifically the hemipenes and the condition of the loreal scale (absent in O. arenarius vs. usually present in O. macrurus). However,
Hemipenes of Oligodon arenarius. A sulcal and B asulcal side of the fully everted hemipenis of ZMMU Re-16804; C partially everted hemipenis of the same specimen demonstrating the overall similar shape to the partially everted organ of the holotype figured by
The skulls of O. macrurus and O. arenarius are quite similar in cranial shape, bone structure, and number of teeth (Fig.
Our phylogenetic analyses demonstrate that the genetic differentiation between O. arenarius and O. macrurus is much lower (p = 0.5%) than the pairwise distances observed in other species within Oligodon. These results are more complex when our morphological data are incorporated (see above), which show significant differences in body scalation and relative tail length between O. arenarius and O. macrurus, but weak differences in other characters (i.e., color pattern, head scalation, hemipenial morphology and cranial osteology). Based on our species concept, delimitation criteria (see Materials and methods) and combined evidence, it is clear that the specific status O. arenarius should be downgraded. However, two taxonomic acts could be considered. Either O. arenarius could be synonymized with O. macrurus as a subjective junior synonym, or O. arenarius could be relegated as a subspecies of O. macrurus. The first decision would eliminate the paraphyly present between the two taxa and consider a single morphologically variable species, while the second would conserve the recognition of a potentially morphologically divergent population but maintain the paraphyly recovered in the phylogeny. We elect to choose the first decision and consider O. arenarius a morphologically divergent population within the variable O. macrurus. Synonymizing the two taxa would not affect the diagnosis of O. macrurus amongst other congeners, and stabilizes the paraphyly demonstrated by our phylogenetic results. Additional justifications for our decision are provided in the discussion section.
The addition of O. arenarius into the synonymy of O. macrurus, along with the paucity of known specimens, prompts us to provide a formal redescription of this species. The type specimen of Simotes violaceus macrurus, collected from “Annam: Pointe Lagan (sur les dunes)” (now Cape Lagan or Mui La Gan, northeast Binh Thuan Province, Vietnam), was once part of the herpetological collection of the Muséum National d’Histoire Naturelle (MNHN) in Paris, but was lost between 1943 to 2009 (
Simotes violaceus macrurus:
Oligodon arenarius
:
MNHN-RA 1928.0119, an adult male from “Annam: Pointe Lagan (sur les dunes)” (now Cape Lagan or Mui La Gan, Binh Thuan Province, Vietnam, 11°10′N, 108°42′E), collected by M. Pierre Chevey on 17 May 1926 (
ZFMK 88885, an adult male from “coastal dune area about 1 km from the coast line”, Mui Ne, Binh Thuan Province (10°57’N, 108°19’E), collected by Peter Geissler on 27 April 2009.
All from Vietnam. NHMUK 1938.8.7.39 male, “Nha Trang, S. Annam” (now Nha Trang, Khanh Hoa Province), collected by M. A. Smith; NHMUK 1969.1854 female, “Saigon” (now Ho Chi Minh City); NHMUK 1969.1855–1856 two females, “near Na Thrang” (now Nha Trang, Khanh Hoa Province); ZMMU Re-11561 female, Nui Chua National Park, Ninh Thuan Province (11°46′N, 109°09′E), collected by V. V. Bobrov on September 10, 2003; ZMMU Re-13857 male, Hon Tre Island, Khanh Hoa Province (12°11′N, 109°17′E), collected by A. B. Vassilieva on 2 January 2011; ZMMU Re-15136 female, paratype of O. arenarius, Binh Chau–Phuoc Buu Nature Reserve, Binh Chau, Xuyen Moc District, Ba Ria–Vung Tau Province (10°29′N, 107°27′E), collected by A. B. Vassilieva on 9 November 2010; ZMMU Re-14502 male, paratype of O. arenarius, Binh Chau–Phuoc Buu Nature Reserve, Binh Chau, Xuyen Moc District, Ba Ria–Vung Tau Province (10°32′N, 107°28′E), collected by A. B. Vassilieva on 9 November 2010; ZMMU Re-14503 male, holotype of O. arenarius, Binh Chau–Phuoc Buu Nature Reserve, Binh Chau, Xuyen Moc District, Ba Ria–Vung Tau Province (10°29′N, 107°27′E), collected by A. B. Vassilieva on 14 November 2014; ZMMU Re-14504 female, paratype of O. arenarius, Binh Chau–Phuoc Buu Nature Reserve, Binh Chau, Xuyen Moc District, Ba Ria–Vung Tau Province (10°29′N, 107°27′E), collected by A. B. Vassilieva on 16 November 2014; VNMN 04274 female, paratype of O. arenarius, Binh Chau–Phuoc Buu Nature Reserve, Binh Chau, Xuyen Moc District, Ba Ria–Vung Tau Province (10°30′N, 107°28′E), collected by N. A. Poyarkov on 10 July 2012; UNS05001–05002, two males, Mui Ne, Binh Thuan Province (10°58′N, 108°20′E), collected by P. Geissler on 4–5 March 2011 respectively (
An Oligodon species distinguished from all other members of the genus by having the following morphological characters: 1) medium body size in adults (TotalL 245–510 mm); 2) a very long relative tail length, especially in males (TAILR 25.4%–37.3% in males, 14.0–19.6% in females; SCR 29.3%–38.7% in males, 20.0%–25.0% in females); 3) head small and slightly spade-shaped, comparatively short and wide (HW/HL 0.53–0.90); 4) dorsal scale rows usually 17-17-15, rarely 18 scale rows anteriorly and 16 rows at midbody; 5) ventral scales 131–152 in males, 139–169 in females, with significant sexual dimorphism; 6) subcaudals 60–94 in males, 36–48 in females with significant sexual dimorphism; 7) total body scales trending towards sexual dimorphism, 191–243 in males, 178–214 in females (178–243 in both sexes); 8) cloacal plate single; 9) 1 preocular and usually 2 postoculars (rarely 1 postocular); 10) nasal scale divided, loreal scale and presubocular condition variable (can be present or absent); 11) usually 8 supralabials (rarely 7), with the 4th and 5th scales in contact with the orbit (occasionally just the 4th supralabial contacting the orbit); 12) usually 9 infralabials (rarely 8 or 10), anterior 4th and 5th infralabials contacting the first pair of chin shields; 12) internasals present, separate from prefrontals; 13) temporal scale formula 1+2 (rarely 1+3); 14) maxillary teeth 9–12, with posterior teeth enlarged and blade-like; 15) hemipenes deeply bilobed, retracted organ reaching the 29th subcaudal in-situ, without spinous calyces and with flounced structures across lobes; 16) dorsal color pattern variable, ochre brown or orange–brown above with light dark brown reticulations and a dark V-shaped nuchal collar present; 17) ventral color pattern pale gray and immaculate.
We compare O. macrurus to other members of Oligodon found in the O. cyclurus-taeniatus species group (
Members of the informal O. taeniatus subgroup (sensu
The O. cyclurus subgroup (sensu
An adult male specimen in good condition, found DOR. Partial incision anteriorly and a longer incision made posteriorly before the cloaca. SVL 279 mm, TailL 146 mm (TotalL 425 mm). HeadL 12.5 mm, HeadW 7.9 mm, SnoutL 3.9 mm, EyeD 1.9 mm, FrontalL 3.5 mm, FrontalW 2.9 mm, IOD 4.4 mm, IND 3.3 mm. TailLR 34.4%, HeadW/L 0.63, SnoutL/HeadL 0.31, EyeD/SnoutL 0.49, EyeD/HeadL 0.15, FrontalL/W 1.21, IND/IOD 0.21, IOD/HeadW 0.56. Body elongated but somewhat flattened due to preservation state, slightly robust anteriorly and at midbody; head ovoid, slightly distinct from neck; snout narrowing in dorsal view, depressed and truncate towards the rostral in dorsolateral view; snout tip terminating past lower jaw; eyes moderately-sized with a round pupil; nostrils pointed laterally; mouth flat, curving slightly posteriorly; tail long, consistent in diameter until the posterior half where it tapers gradually to a sharp terminal scute.
Rostral distinctly enlarged and truncate laterally, wider than high and triangular in dorsal view, partially separating internasals; posterior scale suture of rostral with internasals “deep-V” shaped, vertex of rostral rising far onto the dorsal surface of the head in-line with nostrils as a narrow obtuse angle (~97º); internasals subrectangular, longer than wide, internasal suture shorter than prefrontal suture, anterior border with rostral and nasal concave; prefrontals subpentagonal, longer than wide, wider than internasals; frontal subpentagonal and shield shaped; length of frontal longer than prefrontals and internasals; anterior suture of frontal bordering prefrontals straight but somewhat indented; eyes placed posterior relative to the anterior edge of the frontal; angle formed by the sutures producing the posterior vertex of the frontal narrowly obtuse (~94º); supraoculars subrectangular, longer than wide, narrower anteriorly than posteriorly; length of frontal longer than supraoculars; parietals subpentagonal, slightly longer than wide, width of each scale wider than length of parietal suture; length of parietal scale slightly longer than length of frontal; parietal suture shorter than length of frontal; anterior parietal angle formed by the sutures between the parietal/frontal and the suture between the supraocular/parietal an obtuse angle (~122º) with the lateral ray of the angle pointing posterolaterally; nasal scale subrectangular, longer than wide and fully divided; loreal scale present (1/1), also subrectangular, slightly longer than wide, around half the size of nasal; supralabials 8/8, with the 4th and 5th scales in contact with the orbit; 7th supralabials largest, 1st supralabial smallest; preoculars 1/1; presuboculars (1/1), smaller and less wide than preocular; postoculars 2/2, uppermost postocular larger in size on left side, bottommost postocular on right side slightly wider; temporal scale formula 1+2, uppermost posterior temporal longer with 6/6 scales surrounding scale; infralabials 9/9, first pair contacting eachother; 4/4 infralabials contacting the first pair of chin shields; 5th infralabial largest, 2nd infralabial smallest; mental subtriangular, wider than long; small mental groove present starting below the mental scale where the first pair of infralabials contact, then terminating at the level of the posterior chin shields; anterior pair of chin shields longer than the posterior pair; anterior chin shields slightly wider than posterior chin shields.
Dorsal scale rows 17-17-15, smooth throughout; reduction from 17 to 15 scale rows occurring on 87th ventral on either side; ventral scales 142, subcaudals 87, cloacal plate divided (total body scales 230); subcaudal ratio 38.0%. Maxillary teeth not counted (see General description and variation for details on dentition). The hemipenes were partially everted in an unilobed state, but not fully prepared. The base of the organ is relatively naked with a few flounces present and the sulcus spermaticus partially visible.
In preservative, dorsum light brown with small dark brown or black reticulations formed by dark edges along the dorsal scales; dorsal reticulations concentrated anteriorly and at midbody, whereas the posterior portion of the dorsum is mostly immaculate; vertebrally a series of crossbars, beginning anteriorly as a pair of dark brown spots and continuing as narrow black bars around one or one-half a scale wide, slowly fading in size by midbody and continuing up to the tail as small subrectangular spots. The head is brown dorsally with a poorly defined gray–brown ocular bar edged posteriorly with black, extending across the eyes then meeting at the prefrontals and anterior portion of the frontal; a grayish brown and black-edged temporal streak present on each side of the head starting from the medial portion of each parietal through the posterior temporals and supralabials before dissipating at the gular region. The frontal and parietals have small dark vermiculations present on the scales, along with a dark brown irregularly-shaped spot on the posterior vertex of the frontal and on the suture of the parietals. Along the nape there is a large gray–brown V-shaped nuchal chevron beginning at the posterior end of the parietals around six dorsal scales in length before forking at the nape as a dark brown streak terminating along the flanks of the first two dorsal scale rows. The remainder of the head, including the labial and ventral regions, are beige and mostly immaculate. Ventral surface light brown to beige, immaculate without any spotting or makings. Dorsal surface of tail light brown, immaculate laterally and vertebrally between two dark brown longitudinal stripes originating from the dorsum and extending posteriorly from the cloaca as a pair of stripes extending across the tail to its tip. Ventral surface of tail beige and immaculate.
All examined specimens agree with the original description of the lost holotype and the newly designated neotype (ZFMK 88885). A summary of morphological data for all presently known specimens of O. macrurus is presented in Table
Summary of examined morphological characters for all known specimens of O. arenarius and O. macrurus, with the third column including all specimens under Oligodon macrurus sensu stricto (herein redescribed including O. arenarius as a synonym). All characters include data for both sexes except TailLR, VEN, SC, TOTAL and SC, which are separated based on male (m) and female (f) material. Abbreviations are listed in the materials and methods. Cells denoted with a “/” symbol were unavailable or not examined.
| Character | O. arenarius | O. macrurus | Combined (O. macrurus s. str.) |
| n | 6 (m) 3 (f) | 9 (m) 6 (f) | 15 (m) 9 (f) |
| TailLR | 14.0–27.5 | 14.3–37.3 | 14.0–37.3 |
| 22.09±6.27 | 28.07±8.58 | 25.62±7.96 | |
| TailLR (m) | 25.4–27.5 | 30.0–37.3 | 25.4–37.3 |
| 26.49±0.80 | 34.06±2.18 | 31.03±4.21 | |
| TailLR (m) | 14.0–15.1 | 14.3–19.6 | 14.0–19.6 |
| 14.56±0.54 | 17.61±1.95 | 16.59±2.18 | |
| DSR | 17-17-15 | 17-17-15 | 17-17-15 |
| (18-17-15) | (17-16-15) | (18-17-15, 17-16-15) | |
| VEN | 131–143 | 135–169 | 131–169 |
| 135.9±4.8 | 149.0±10.3 | 144.1±10.5 | |
| VEN (m) | 131–136 | 135–152 | 131–152 |
| 133.2±1.8 | 142.7±5.6 | 138.9±6.5 | |
| VEN (m) | 139–143 | 150–169 | 139–169 |
| 141.3±2.1 | 158.7±6.5 | 152.9±10.1 | |
| SC | 36–60 | 44–94 | 36–94 |
| 50.8±10.7 | 70.3±18.3 | 62.5±17.8 | |
| SC (m) | 55–60 | 75–94 | 55–94 |
| 58.3±1.9 | 82.9±6.3 | 73.1±13.4 | |
| SC (m) | 36–40 | 44–53 | 36–53 |
| 38.0±2.0 | 48.2±3.4 | 44.8±5.9 | |
| TOTAL | 178–195 | 203–243 | 178–243 |
| 187.6±6.5 | 220.3±12.3 | 207.5±18.5 | |
| TOTAL (m) | 188–195 | 211–243 | 188–243 |
| 192.5±2.7 | 226.6±10.6 | 212.9±19.1 | |
| TOTAL (f) | 178–183 | 201–214 | 178–214 |
| 180.3±2.5 | 207.7±5.1 | 198.6±14.3 | |
| SCR | 20.0–31.3 | 20.6–38.7 | 20.0–38.7 |
| 26.91±4.89 | 31.64±7.00 | 29.72±6.39 | |
| SCR (m) | 29.3–31.3 | 34.72–38.68 | 29.3–38.7 |
| 30.30±0.71 | 36.55±1.43 | 34.05±3.38 | |
| SCR (f) | 20.00–21.86 | 20.56–25.37 | 20.0–25.4 |
| 21.07±0.96 | 23.22±1.86 | 22.50±1.88 | |
| SL | 8/8 | 7/8 or 8/8 | 8/8 |
| (7/7) | (8/7) | (7/7, 7/8, 8/7) | |
| SLE | 4+5 | 4/4+5 or 4+5/4+5 | 4+5/4+5 or 4/4+5 |
| (4/4) | (3+4/4+5) | (4/4, 3+4/4+5) | |
| IL | 9/9 | 9/9 | 9/9 |
| (7/9) | (8/8, 8/9 or 10/10) | (7/9, 8/8, 8/9, 10/10) | |
| ILCS | 4/4 | 4/4 or 5/5 | 4/4 |
| (3/4, 4/5 or 5/5) | (3/4, 4/5, 5/5) | ||
| PtO | 2/2 | 2/2 | 2/2 |
| (1/1, 1/2 or 2/1) | (1/1, 1/2 or 2/1) | ||
| PT | 2/2 | 2/2 | 2/2 |
| (2/3) | (2/3) |
SVL 210–320 mm (212–320 mm in males, 210–319 mm in females); TailL 35–190 mm (72–190 mm in males, 35–75 mm in females); TotalL 245–510 mm (284–510 mm in males, 345–385 mm in females). The largest specimen is an adult male (UNS 5001) with a SVL of 320 mm and TailL of 190 mm (TotalL 510 mm; TailLR 37.3%). HeadL 8.9–14.3 mm, HeadW 6.1–10.3 mm, SnoutL 3.1–4.9 mm, EyeD 1.5–2.1 mm, FrontalL 2.8–4.2 mm, FrontalW 2.3–3.4 mm, IOD 3.6–5.6 mm, IND 2.1–3.8 mm; TailLR 14.0%–37.3% (25.4%–37.3% in males, 14.0–19.6% in females), HeadW/L 0.53–0.90, SnoutL/HeadL 0.30–0.40, EyeD/SnoutL 0.35–0.52, EyeD/HeadL 0.13–0.18, FrontalL/W 1.10–1.35, IND/IOD 0.44–0.73, IOD/HeadW 0.48–0.64. Rostral distinctly enlarged and truncated laterally, wider than high, triangular shaped in dorsal view, partially separating internasals; posterior scale suture of rostral with internasals “deep-V” shaped; internasals subrectangular, longer than wide, internasal suture longer than prefrontal suture, anterior border with rostral and nasal concave; prefrontals subpentagonal, longer than wide, wider than internasals; frontal subpentagonal and shield shaped, length longer than prefrontals; anterior suture of frontal bordering prefrontals broad, either concave or straight; eyes placed posterior to the anterior margin of frontal; angle formed by the sutures producing the posterior vertex of the frontal a narrow obtuse angle; supraoculars subrectangular, longer than wide, length of frontal longer than supraoculars; parietals subpentagonal, slightly longer than wide, width of each scale wider than length of parietal suture; length of each parietal scale equal or slightly longer than length of frontal, but length of the parietal suture shorter than length of frontal; anterior parietal angle formed by the sutures between the parietal/frontal and the suture between the supraocular/parietal a broad obtuse angle with the lateral ray of the angle pointing posterolaterally. Nasal scale subrectangular and longer than wide, fully divided; loreal scale condition variable, 1/1 or 0/0 (0/1 in two specimens); when present, loreal square or subrectangular-shaped, slightly longer than wide, around half the size of nasal; supralabials usually 8/8 (7/7 in one specimen, 7/8 in four specimens, 8/7 in one specimen), with the 4th and 5th scales in contact with the orbit (3rd and 4th scale in contact on one side in one specimen, just the 4th scale in contact on both sides in one specimens, on one side in four specimens); 7th supralabial largest, 1st supralabial smallest; preoculars 1/1; presubocular usually present (1/1) but sometimes absent (0/0 in five specimens), when present smaller than preocular; postoculars usually 2/2 (rarely 2/1 in one specimen, 1/2 in two species, 1/1 in one specimen), uppermost postocular usually larger in size when two scales are present (occasionally the bottommost postocular is wider); temporal scale formula 1+2, with one specimen having 2/3 posterior temporals; infralabials usually 9/9 (rarely 8/8 in two specimens, 8/9 in two specimens, 7/9 in one specimen, 10/10 in one specimen); first pair of infralabials in contact with each other; usually 4/4 or 5/5 infralabials contacting the first pair of chin shields, one specimen with 4/5 and another with 3/4 infralabials in contact; 5th infralabial largest, 2nd infralabial smallest; mental subtriangular, wider than long; small mental groove present, starting below the mental scale where the first pair of infralabials contact and extending until the posterior chin shields; length of anterior pair of chin shields longer than posterior pair; anterior chin shields slightly wider than posterior chin shields.
Dorsal scale rows 17-17-15 (rarely 18-17-15 in two specimens, or 17-16-15 in two specimens), smooth throughout; reduction from 17 to 15 scale rows occurring on ventrals 71–98; ventral scales 131–169 (131–152 in males, 139–169 in females); subcaudals 36–94 (60–94 in males, 36–48 in females); total body scales 178–243 (191–243 in males, 178–214 in females); subcaudal ratio 20.0%–38.7% (29.3%–38.7% in males, 20.0%–25.0% in females). Maxillary teeth 9–12, all blade-like, with the posterior two or three greatly enlarged.
Most O. macrurus specimens exhibit a similar color pattern, but some intraspecific variation is present. The dorsum in-life is ochre brown, light brown or orange–brown, and all specimens have small dark-brown reticulations across the body formed by dark edges along the dorsal scales; dorsum usually darker vertebrally, occasionally with two darker lines creating a small weakly-distinguished and dusky pair of longitudinal stripes, especially distinct on the tail. The head is marked with a dark ocular bar that extends across the eyes and meeting at the prefrontals and anterior portion of the frontal, a temporal streak on each side of the head starting from the parietals to the supralabials and flanks, and a V-shaped nuchal chevron. The ventral surface is plain white or beige and without any spots or blotches. Three main color variants can be observed, well correlated with geographic location. The first is a “north” form observed in specimens from Khanh Hoa Province (NHMUK 1938.8.7.39, 1969.1855–56, ZMMU Re-13857). In these individuals, the ocular bar is indistinguishable or barely distinguishable from the rest of the head, the temporal streak is faint (and reduced to the lower half of its length in NHMUK 1938.8.7.39 and NHMUK 1969.1855), and the narrow V-shaped nuchal collar is only 2–4 dorsal scales in length and of equal width. There are no dark markings on the frontal scale, and the dorsum has small dark brown crossbars starting posterior to the nuchal collar fading by midbody to small indistinguished reticulations. The second “middle” form (Figs
Photographs of the preserved neotype of Oligodon macrurus (ZFMK 88885), an adult male specimen. A dorsal and B ventral views of the whole specimen, and C dorsal D ventral, E right lateral and F left lateral views of the head. Scale bars for A–B represent 10.0 mm, and scale bars for C–F represent 5.0 mm. All photographs taken by Morris Flecks, used with permission.
Living specimens of Oligodon macrurus sensu stricto from various locations in southern Vietnam. A adult male ZMMU Re-16807 from Mui Ne, Binh Thuan Province, representing the ‘middle’ color phase; B adult female VNMN 04724 (formerly ZMMU NAP-03884) from Binh Chau-Phuoc Buu Nature Reserve; C and D two adult males ZMMU Re-16804 and ZMMU Re-16805 from Binh Chau-Phuoc Buu Nature Reserve, Ba Ria-Vung Tau Province, B–D formerly identified as Oligodon arenarius. Photographs taken by Hieu Minh Pham A and Nikolay A. Poyarkov Jr. B–D.
The description of the skull of Oligodon macrurus is based on 3D reconstructed µCT-scans of two specimens: ZMMU Re-13857 and ZMMU Re-14502 (one of the paratypes of O. arenarius); (Fig.
Three-dimensional CT reconstruction of the skull, lower jaw and maxilla of A–C Oligodon arenarius (ZMMU Re-14502, paratype) and D–F O. macrurus (ZMMU Re-13857) showing A1, D1 dorsal, A2, D2 lateral, and A3, D3 palatal view of the skull labial view. B, E of the lower jaw, C1, F1 labial, C2, F2 lingual, and C3, F3 dorsal view of the maxilla. Reconstructions by Elena V. Syromyatnikova.
The braincase is composed of compactly ossified bones consisting of the frontals, parietal, basisphenoid, basioccipital, prootics, supraoccipital and exoccipital; partially fused to each other forming the complete enclosure of the brain. Frontals well separate. Parietals elliptical shaped and the largest cranial element, fused together to form a single bone that dorsally roofs the braincase, bearing no elaborated crests; laterally parietal extends far down contacting the basisphenoid and the prootics. Basisphenoid and parasphenoid fused with each other, forming the posterior snout and anterior floor of braincase. Basioccipital forms the floor of the posterior portion of the brain cavity, and completes the foramen magnum creating a large and raised occipital condyle. Left and right prootics large, subrectangular ventrally and dome contoured dorsally, partly fused with the parietal and forming the anterior walls of each internal otic capsule; prootics form the anterior half of each fenestra ovalis and the posterolateral wall of the braincase. Supraoccipitals fused together to form a single bone, externally roofing the posterior brain cavity, internally expanding to form the posterior part of each otic capsule. Exoccipital forming the posterolateral wall of the braincase and part of its roof; exoccipital fused with the opisthotics, surrounding the jugular foramen and extending forward to form the posterior border of the fenestra ovalis, the entire oval foramen magnum, and a small ventral portion of the occipital condyle along with most of the basioccipital. Stapes slender, rod like, proximally enlarged and form a footplate fitting into the fenestra ovalis and distally connect to the inner surface of the quadrate at about mid length level.
The palatomaxillary arches consists of the palatine, pterygoid, ectopterygoid and maxilla. Palatines long and narrow, in contact with the prefrontal process of the maxilla laterally and pterygoid posteriorly; 7 small sized palatine teeth. Pterygoids long and slightly bent bones, narrower anteriorly, flattened posteriorly, and extend from the posterior palatines to the posterior mandible. Each pterygoid bears 10–12/9–10 teeth. Ectopterygoids flat, bifurcate anteriorly, notched posteriorly and connect the maxillae to the pterygoids. Left and right maxillae comparatively straight and posteriorly broadened due to the dorsal ridge, connected to the flattened ventral surface of the ectopterygoid by a mesial process; the maxilla medially contacts the ventral surface of the prefrontal. Each maxilla almost has no edentulous region anteriorly, and bears 10 to 12 teeth, with the posterior 2–3 enlarged and blade-like. This number of maxillary teeth agrees well with the known data for O. macrurus and differs from the data represented in the original description of O. arenarius (
The suspensorium contains the quadrate and supratemporal, connecting to the mandibles by elastic tissue. Supratemporals narrow, flattened, dermal elements, connected to the proximal end of quadrates and the posterolateral part of braincase by fibrous connective tissue; each is long, straight, slightly bent toward the braincase, and overlay the exoccipital and prootic. Quadrates long, widely flattened, concave dorsally with a fenestra found posterolaterally; proximal end contacting the posterolateral edge of each supratemporal; distally articulated surface of each quadrate narrow, extended transversely and directed backward. Mandibles long and connected to each other anteriorly by an elastic ligament; each composed of the compound, angular, splenial and dentary. The compound is strongly concave dorsally, narrow distally, and massive and laterally flattened proximally; prearticular crest higher than subarticular crest. Angular and splenial both triangular shaped elements that fuse at their broadest point of contact. Dentaries somewhat dorsally curved, bearing sockets for closely set 14–15/14–17 small teeth that decrease in size posteriorly.
To date O. macrurus is reliably known from five provinces in southern Vietnam (Khanh Hoa, Ninh Thuan, Binh Thuan, Ba Ria–Vung Tau and possibly the vicinity of Ho Chi Minh City), where it is only found in coastal ecosystems associated with the Mui Ne dunefields and sandy coastlines to its north and south (Fig.
The specific name “macrurus” is a Greek adjective derived from the words “makrós” (μακρός) meaning “long”, and “oύrá” (οὐρά) meaning “the tail”, here latinized as -urus and thus literally denoting “long-tailed”. Common names previously attributed to this species include “Angel’s kukri Snake” (English) and “Oligodon anzhela” (Russian). The synonym O. arenarius was not given a common name during its description, although “Dune kukri snake” has sometimes been attributed, due to its epithet translating to “coast” or “dunes”. Since this species now includes this combination, we herein suggest the common name “Long-tailed kukri snake” (English), “Rắn khiếm đuôi dài” (Vietnamese), and “Dlinnohvostiy oligodon” (Russian), respectively, for O. macrurus, which directly translates to its Greek species epithet.
This species is now known specifically from seven localities across the coast of southern Vietnam. A few of these sites are found within nature reserves and other preserved tracts of land, however human development and increased tourism around these areas could pose a significant threat to this species.
Using an integrative taxonomic approach, we found that the recently described kukri snake O. arenarius represents a junior synonym of the species O. macrurus. Our study also provides new data on the distribution, taxonomy and phylogenetic position of O. macrurus and confirms its confinement to the coastal dunefields and sandy regions of southern Vietnam. The weak genetic divergence (less than 1.0% pairwise distance) and non-monophyly of O. arenarius certainly justifies its demotion from species rank. However, the significant differences in body scalation and relative tail length may lead some readers to question whether O. arenarius should be considered a subspecies of O. macrurus instead of a junior synonym. In herpetology, the contemporary application, criteria and usage of subspecies is controversial (
Morphological comparisons between Oligodon macrurus sensu stricto and the other species of Oligodon native to Vietnam. Characters highlighted in bold are considered diagnostic. Abbreviations for characters can be found in the materials and methods. Data for other species are based on the following literature sources:
| Character | O. macrurus | O. annamensis | O. barroni | O. catenatus | O. chinensis | O. cinereus | O. condaoensis | O. culaochamensis | O. deuvei | O. eberhardti | |
| TailLR | 25.4–37.3 (m) | 16.5–19.7 (m) | 17.0–18.9 (m) | 12.0-13.3 (m) | 18.7–19.5 (m) | 12.1–15.6 (m) | 12.8–13.2 (m) | 21.8–21.9 (m) | 15.8–17.2 (m) | 10.8–15.1 (m/f) | |
| 14.0–19.6 (f) | 11.6–13.5 (f) | 13.7–14.9 (f) | 10.2–10.7 (f) | 15.2–15.8 (f) | 9.4–13.3 (f) | 12.6 (f) | 16.6–16.9 (f) | 13.2–14.9 (f) | |||
| MT | 9–12 | 7–8 | 10–12 (13) | 7 | 9 | 10–13 | 11–13 | 9 | 12–15 | — | |
| DSR | 17(18)-17(16)-15 | 13-13-13 | 17-17-15 | 13-13-13 | 17-17-15 | 17-17(15)-15(13) | 17-17-15 | 17/19-17-15 | 17-17-15 | 13-13-13 | |
| VEN | 131–152 (m) | 146–157 (m) | 136–147 (m) | 179–203 (m) | 175–184 (m) | 155–182 (m) | 168–172 (m) | 175–184 (m) | 140–147 (m) | 165–174 (m) | |
| 139–169 (f) | 155–170 (f) | 141–160 (f) | 190–212 (f) | 182–206 (f) | 162–185 (f) | 169–176 (f) | 179–182 (f) | 147–155 (f) | 179–187 (f) | ||
| SC | 60–94 (m) | 43–46 (m) | 36–48 (m) | 31–37 (m) | 60–64 (m) | 33–45 (m) | 37 (m) | 63–66 (m) | 36–47 (m) | 37–40 (m) | |
| 36–48 (f) | 30–34 (f) | 28–35 (f) | 30–43 (f) | 47–53 (f) | 29–39 (f) | 33–34 (f) | 51–52 (f) | 31–38 (f) | 31–34 (f) | ||
| CP | Single | Single | Single | Divided | Single | Single | Single | Single | Single | Divided | |
| SL | 8 (7) | 6 (5) | 7–8 | 6 | 8 (7) | 7–8 | 8 | 8 | 7 (8) | 6 | |
| SLE | 4+5 (3+4) | 3+4 | 3+4–4+5 | 3+4 | 4+5 (3+4) | 3+4–4+5 | 4+5 | 4+5 | 3+4 | 3+4 | |
| IL | 9 (7–10) | 6 | 8–9 (7) | 6 | 9 (8) | 7–8 (9) | 8 (7) | 9 | 8–9 | 6 | |
| LOREAL | 0–1 | 0 | 1 | 0 | 1 | 1 | 1 | 1 | 1 | 0 | |
| PtO | 2 | 1 | 2 | 2 | 2 | 2 (1) | 2 | 2 | 2 | 1 | |
| AT | 1 | 1 | 1 | 1 | 1–2 | 1–2 | 1 | 2–3 | 1 (2) | 1 | |
| PT | 2 (3) | 2 | 2 | 2 | 2 | 2–3 | 2 | 2–3 | 2 | 2 | |
| Character | O. fasciolatus | O. formosanus | O. lacroixi | O. moricei | O. mouhoti | O. nagao | O. ocellatus | O. rostralis | O. saintgironsi | O. taeniatus | O. tuani |
| TailLR | 15.5–21.6 (m) | 16.5–19.5 (m) | 10.5–12.4 (m/f) | 13.3 (f) | 17.2–18.5 (m) | 13.9–14.6 (m) | 11.6–14.2 (m) | 19.6 (m) | 19.1–20.3 (m) | 16.5–20.4 (m) | 18.4–18.8 (m) |
| 11.6–15.8 (f) | 14.9–16.4 (f) | 12.2–13.1 (f) | 10.6–11.4 (f) | 16.1 (f) | 12.8–15.1 (f) | 12.3–14.2 (f) | |||||
| MT | 8–10 | 7–10 | 8–12 | 12 | 14–16 | 9–10 | 9 | 6 | 10–12 | 15–18 | 10 |
| DSR | 21/23-21/19-17/15 | 19-19/17-15 | 15-15-15 | 17-17-15 | 17-17-15 | 17-17-15 | 19-17-15(13) | 15-15-13 | 19-17(18)-15 | 19-19-15 | 19-19-15 |
| VEN | 160–186 (m) | 155–176 (m) | 162–178 (m/f) | 175 (f) | 145–152 (m) | 184–193 (m) | 159–166 (m) | 167 (m) | 166–170 (m) | 142–159 (m) | 173–179 (m) |
| 163–196 (f) | 164–189 (f) | 154–163 (f) | 157–180 (f) | 184 (f) | 151–165 (f) | 187–193 (f) | |||||
| SC | 43–61 (m) | 49–55 (m) | 25–34 (m/f) | 41 (f) | 39–43 (m) | 43–47 (m) | 32–44 (m) | 47 (m) | 55–59 (m) | 38–48 (m) | 58–59 (m) |
| 34–48 (f) | 43–48 (f) | 29–33 (f) | 26–33 (f) | 53 (f) | 31–39 (f) | 44–45 (f) | |||||
| CP | Single | Single | Divided | Single | Single | Single | Single | Single | Single | Single | Single |
| SL | 8 | 7–8 (6) | 5 | 8 | 8 | 8 (7) | 8 (7) | 6 | 8 | 8 | 8 |
| SLE | 4+5 (3+4) | 3+4–4+5 | 2+3 | 4+5 | 4+5 | 4+5 (3+4) | 4+5 | 3+4 | 4+5 | 4+5 | 4+5 |
| IL | 8–9 | 9 | 6 | 9 | 9–10 | 8 (7) | 9–10 | 6 | 9 | 9 | 9 |
| LOREAL | 1 | 1 | 0 | 1 | 1 | 1 | 1 | 0 | 1 | 1 | 1 |
| PtO | 2 | 2 | 2 | 2 | 2 | 2 | 2 | 1 | 2 | 2 | 2 |
| AT | 2–3 (1) | 1 (2) | 1 | 1 | 1 (2) | 1 | 1–3 | 1 | 2 | 1 | 2 |
| PT | 2–3 | 2 | 2 | 2 | 2 | 3 | 2 | 2 | 2 | 2 (1) | 2 |
Our study attempted to examine all material available for O. macrurus, but still has limitations related to sample size and geographic scope. In total, we examined 24 specimens of O. macrurus and O. arenarius, yet it is still difficult to conduct analyses related to geographic variation with such a sample size, which could reveal clinal patterns in the number of body scales and body size (sensu
As mentioned previously, members of Oligodon have traditionally been partitioned into several informal groupings based on hemipenial morphology, scalation, and dentition (
So far, all recent reports of O. macrurus have been from dunefields and adjacent sandy habitats surrounding the southern coast of Vietnam. Based on geological evidence, most of the dunefields in southern Vietnam were formed during the last interglacial period of the late Pleistocene, with deposits continuing throughout the Holocene as a result of climate change and alterating monsoon conditions in the South China Sea (
Permission to conduct fieldwork in Ba Ria–Vung Tau Province was granted by the Bureau of Forestry, Ministry of Agriculture and Rural Development of Vietnam, by local administration (Peoples’ Committee of Ba Ria–Vung Tau Province: No 14449/UBND–VP of 21.12.2020) and by the southern branch of Joint Russian–Vietnamese Tropical Research and Technological Center (JVRTRTC) in Ho Chi Minh City (No 769/CNPN of 03.12.2020). PVY and NAP thank Anna A. Bannikova for her kind permission to conduct molecular research in the genetic laboratory of the Department of Vertebrate Zoology, Lomonosov Moscow State University. We are grateful to academician Alexey V. Lopatin (Paleontological Institute of the Russian Academy of Sciences, Russia [PIN RAS]) for the permission to work on the μCT-tomograph of his institution, and to Roman A. Rakitin (PIN RAS) for constant help and assistance during the processing of our specimens during the µCT-scanning. We also thank Valentina F. Orlova (ZMMU), Ivan Ineich (MNHN), Patrick D. Campbell (NHMUK) and Claudia Koch (ZFMK) for permission to examine specimens under their care. Our sincere thanks go to Morris Flecks (ZFMK) who provided us with excellent photographs and measurements of the neotype of O. macrurus; Tan Van Nguyen (DTU), who collected morphological data on additional specimens of O. macrurus and helped clarify important details on localities in southern Vietnam; and to Gernot Vogel (Heidelberg, Germany), who while not sharing all of our viewpoints, still provided insightful discussions on Oligodon taxonomy and auxillary assistance. Patrick David (MNHN), Frank Tillack (Museum für Naturkunde, Berlin) and an anonymous reviewer provided useful comments and suggestions that greatly improved earlier versions of this manuscript. We are also indebted to the editorial team of Zootaxa (Magnolia Press) for permission to use an image from